Description :
From Genome Similarity Track
Location :
Scaffold_24:43320- 46736
Transcript NameFunction/comments
Hyaar_Emoy2803877AlNc14C321G10591
Hyaar_Emoy2803878hypothetical protein

Sequence
3416 bases(100 bases per row)
TACAGACGCGCGGCAGAGACGCAGCAGCTGGTGATTGAAGAGCTTCAGACACAAGTCAAGCAGCTGCGGAGCTCTAATTACCGACTTCAGTATATCGTGC
AGCAGCACGAGCCACGAGGTCCAGGCTCGTTTTTACCACCGCGGCCGCCAGATATTTGTTGAGAAAAAGAACAAGAGTGCTACACTTTTTCACTCGATGA
GGGACAGACAAGCCGAGCACATTGTGTAATATGTTATGTAATGAGAGCGAGAGAGAATGGTAAAACCGGGGGGCAGGCTCCTTCTCGTCGTGTCGTCGAT
GTATGAGAGGAACCACAGAGGAATGCAGAAGCGGCAACCGCAGGCATGCTGCATGTATTTTGGTTGTTCTTGCCGATATACTGGGTGAGTACTAAAACAA
TGGTGGAATGAAGCAAGCTTGTGGTCGCAAAGAGTCGCGCTACGATAGGATGTGGCGGCTATATATCAAAGGCTAAAACTTTCGGTAGGATTCTGTTACG
CGTTGCTTATTGGTGAGCATCAACCACTTCGATCGACTTGATCGTGGACTTGACGGGGATCTGCATCGGACAACTATAGTAGCCGCTGAATAGTGTTAGG
TCATTGTGTCAAAGCGATAAGTAAAAAATGAAGAAGCTTGTTTAAGTAACATTTCTTACAATGCATGAGCTGTTGTTGCGATTGTACGACAAACGTGTCA
AGTTCTTCGTTTGGATCTGAATCGATCTCTAGTGTAAACGGTGCCCTGTACAAAACAGCAGACCTACTGGAATAAGCCAATTAGTCACCGCAAATTCCGA
TTGTTGTGCGACTGTAATCTATTTCTAAAATTAAAATTTCGAGCGTTAAAATAATACTAGCATTAACATAGGTCTGTCCGGATACTACGTGACTCACTCT
AACGGTGCGGTTCATATAACTCCATAATAGAATTAAGTGACCCACTCCCACTCGGACATCGACGTCTGTGGCTCAACTCGTGAGCAGGACAACGTCAAGT
TTAAAAACGTGATGCTCCTCCTCGTGCTGCGTCGTCCGTCCGTGCAACGCCATTTGGCACCCCAAGGCCGTCTCGTCCACCAGTTTGAGCCTCTTCGCTG
GTTCAGCTCCACGTACATACGTCTTTGTTTAGCTTCATATAATAAATAAAGTTTTAGTACTAATTAATAACAACTAGGATGGGGCGATCGTTAACTCACG
TCCACTTTATGTATATTTGTCTGTGTGTGTAGTATTCTGCCAAAGAAAAAAGAAAAGAGCAGTGAGGAAGCAAAAGAGACCAACACCAAGTTGTGGGACA
GAGTACTGGCGAATCAACCGGATCAGGCAGAGACGCAGAGAGGTGATCTACTCTACGAATACGTGCGGAAGGTACGCACACGATAAACTTGACAAAAAGC
CACAAGTAGGAGCAAAAAAGAACGGGAAGAGGTTGACGACATGTTGTTGTTTGTGTGGGGTTCTATAACCATGTCACCTAGCGCTATTTCGGCCTCATGT
CGGCCGGATCTCTTGCTCATGTATGTCATGGAGTAATAATCCTGAATACCTGACTGGCCACTAAAAGCTATTTTTTAATTCTGACATTGGTATTGGGATT
ATTATGGTGGTATAGATTGCCTTCTGGTCGTGGCTCAAGGGTTATGAGCAGAGTCTTGTGGAGAGTGAGTAGTTAGAAGATAGTAGGTGTTTTTATCTTT
GAAGTAAATTTGTGTCGGGTGCTTTTAAATTATTTCTGCTCTGTAGTGCACCCGGTGCTGGGCGAGCCGACGCTCTTTTCGTTCATTTCGGATGATTTCG
GCTCCTCTGTTGGCTTCGGCACGAGTATTCTGCTGGCTGGACTCATTGGTTTTCAAGCAAAAGTAAGAGTAAACAAATTGTATGACTCTGATTGGGATCC
ATCCGTTCAAGTAGTGACCATTGTTGTGGCAAATTGTTGATTCTACAAGCGAACGGTCGCCCGCATCTCGGTTGTTGCTGGTGGGGACAAGCTGCGCTTC
ACGAACCACAAATTCTTTGGAGTACGTTGTGTTGGCTGACTATCGCAAAACTTGGTCAAGTTGTTGCTTATTGTTTCGATTATCGTATGGGTGTGGTAGA
ATTTAGGAACGCCCATTGACGTACCGGTCTCGTATGTGTCTGCACACCCCAACACCAAAAACAACATTATCCTTAAGCTAGCCAACACGCGCGGTTTTTT
TCTTGTGGACACGAAAGGCAGTTTCTTTAACCGCGATAAGCTCGAGCGGATGATTACGTTTCGCACCAATTTTGTAAGAACCGAGGATGGTGTTCTGGTT
ATGAGAAGAGCAGTCTGATATTTGACCTGCTGTTCACAGAGAGAGCACGAAAAGATGATGGAAGAGAAGACGACAGTAAAAGTACGGACGGACTTACCGC
GTGTGGATCTGAAGACCGAAACAGCGCAGAACGCGGCCAAGCGAAAACTCCCGGCAGGACCGCACTCACCGGCCCGCCATGGGAATTTACTTGCCAAGAA
GCACACAAAAGTGAAGAAGCGTGGCAAGAAGAAGTAGGCCTCAGATGCTACGGGTAGTGCGCAGCCAACTCTAGCATTTTGGCCTGATCCGTGGAGATTG
CAGCATTTATCAGAGCGACGTTGCTCGTAGATTTGATCAGATTTAGACGAAGCAGAAGAATGACCTACATAGATTAGCTGAGGCTTTGTCACTGTTGCGG
CGCGTTTAACGGTAGAACCATTATGTCTACGCGAATCGTGCGTTGTTTTAAAACATTTCATAGTGGTGACGAATACAGAATAACAATCACGGCACTTGTC
TTGGTGGCCGACAAATGTTCTAGATAAATAGATGAATCCGCGACAATTTTAAAATTCTTCATTTTGGTCCTGTCGTCAGTAGCAAATTCGAAAATGACTG
TACTGTGTCGTTTAAGTCGTATCGTCATTTTCCTCGTGTTAACACGAATAAAAAGAATGGCTCGTGACTGATCGAAGGAAGATGTAATCTGTTGTTGAGA
TACGAAACATCCTGTTCTAAATAATTGACCCTTTAGCGTTTGCACAAGAATACGTAGCTTCGTATATCGATGCCTTAACATGCATGGACAGCGTGCTGCA
AAGCGCGGGTTATCACACATGGCACATCAAACCGGAGTGAGCACGATTGTGCCACGGAATCTTACCGAAAACTTTTTGTCAACGCTTATTTGCCCACGGT
CGGTAGATTCTCCTGTTCCTACTTTCGAACGAGCGAGATCGTGAAATCGAGATAAGTTGTTCCGACTGATGGCACTGCCACCTTCACGAACAGATATAGT
CACGTATATATTATCGTACGAGGCGCGCCTCTTGCAATGTCGTTTGTTGCATGAATGGAATCGCCCAGCTGCTTGATCGTTGCAGAGTAATTAACAGGTG
AAAGTATGTTTGGAGA