Description :
From Genome Similarity Track
Location :
Scaffold_24:43319- 53477
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.12Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.25Ferredoxin
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.13WD repeat protein

Sequence
10158 bases(100 bases per row)
TGTATGTAGCTCTTGGGTTCGGTTTCTTCCACAGTGGCATCGAGATTGCGGGCGACGAATACTCGTTTGCAAGCGGCGCGGGAATCTTTATTTCTACACC
AAAGCAAGCTGCAGGTACGAGAGTGTGTATTTTCCGTACAAGATGAACAGCAGGGATTCATCACTGCATGCACTGATGTTTTCTATGCTTAATCCAATGC
TAGGCGCGGTGTTTCGCGAATCGATTCTGTTGGGTAACTTCCAAGGCTCTTACACTGAGGCAAAGCAGATCGCGTACTCGCTGCAGTCGGATTTTGAAGG
AAACACGTACAACCTTGTGACAAAGTACGGATGTCGCTCCACGGGTTGGCGAAGCTACCTTGTTTGCTTTTGTTGATGAATCTGGCTGGATCATGTAGGA
ACTGCAATGCGTACTCCGAAGCGCTGTGCCGAGAGCTGCTGGGAAAGTCGATCCCTGCGTACGTGAATCGTGCAGCGTACTTGGGCTCGTTCTTGAGCTG
CTTGATGCCTGCGGATCTCGGTGGCCAGGCTCCAGTGGGGGCGACGTCGACTACTTCTTCATCATCGCGTCTAACGAACGGGCCCACCTACTCTGCGTTT
GCTGGTAAGTTTTGCGGCGAGTTGCCTTAGATATTGATACTGTGTAGAGTGTGTAGCTGATCGTTAGTTTGCATCATTCTGTAGGTTCTGGACAAGCAGT
TGGTGGTACGTCCATCTCATCCAGTTCTACTACAACCAGTGAATCCACACTTTCAGATCGGCGGGAGAAGTTGCGGATGGCAGCATTGAGACGATTCGAG
ACTCAACAAAAGTAACGCATCTTTTTTTCCAAATGAGCGAGTCTCTTTTAACAGAGCGCAAAATGGGAAATGCAGCTGGCGTGATTCGCATCAGAGCACC
CTTTTCATGCTGTGCTACTGCATTCTCTTTTCATGTGCATCTAACTTTTTTATCGAAAGCCGCCACACTCGTGAAAACCAAATCAAGTCAACTCGTTGGC
CAAAACCTGCTCGGTGCGTCTGGGGTTGATCATATATATATATGGCTTCAGTTACACATTGATGGCCGTCGTGACGCGTTTCAAGAAGAACCCAGCGCGT
CGGTCTAAGAGGTTTTCTGCCCGCAGCGTTTGTTCTTCCCTTCTCGAGAGTGTCAAATGCAAGAAACAAAAAATAAGGAGATGGGGAAAGCGTCTTCGCC
CGTGAAGAAAGCTCCCGGTCCTCTCAATAGCAAAGCAGCGCCGAATGGACCACGCGAAGTCGTTGGCGCGCGCTCGTTTGACGATTCGCTGGTCTTGGAT
GGACGCGTGGAGCGCGTTGAAAGCACGATCGTGAATCGCGAAACGGCGACGCACTTGGCATTCGCAAAGAGGTATGTATCTCATTGTCCATGACGCTATG
CTTCTGCGCCTCGATATTCTGGAACTAATTGTGGAATAAACGTGTCTGATATGCTGTAGCCGGAAAGACGATTTCGCGTTTGCGCCGTCGCCCCATTACG
TGCAAATCCTGAACAACTACTGCCACTGGGACCGAGATGCAAGCCACTCGTCGATCTTGGTTGTCGTAGGCCAGCCAGGAAATGGCAAGTCGGCACTGCT
CGCCCACTGGGCTGAAGAGCGTCGTCGGTCAGAAGAAGGAGCCGAGGAACTGATCTACGAGCACTACTCTGGATGCTCGTACGACAGCGTCAAACTGTCT
CTGTTTCTGTTTCGATTCATGGCGCAGATCAGAACCACGTACATGCTCCGGGATTTCGAGCTCCCACGCGAGCACGAGGAAGAAAAACTCAAGTTTTCTT
TCGGACGGTGCCTGGAAGCAGCAGTGGGTCGAACGAACCATATCTCAGGAACGAACTCCAAGCTCAAGCGGTACGAAGCTTTGATGCATTACTTTACTGC
TACATCCGTCGTAAACTGAAAAATGTTTGCCATCTTTTTTAGAATAATTCTAGTACTGGATGGAATCGACTGCATTCGGAATGAAGATGGCGGAGACTCG
CTTTCGTGGCTGCCAACGTCGTTCCCGGCAAACGTGCGAATCATTGTATCGGCCACGCAAACTACCGTCAGGGGCAAGAACCATTTACGCTGCTGCAAGT
GGACCATCCGCAAACCGATTGTGTATGACGATGAGTAAGTGCCTACCTAGTTACATTCGTGATATTACTACTGCATTCCAGCCGTTCACGTGATTGACAG
CATTTTCTTTTACCAGTGATGATTTAGTGTACGATACATCATTACCACCTCAGGACCACGACTCTCATACAATTCGAGAGCTTCGACGGCGGCAGTCGAC
GTTCGTTGTGGTTGAACCACTCGATGAGCATGCTTGCCGAGCTATTCTTCAAGTATGCGCAACACATCTTCACTCATTTGTTGTGCACCCGTATTGGATC
TCATCTTCTGCCAATGATGTTGCTGATTTCCATGCATTCCATAGGCGTATGAAGAAAAGTACTCGCGCACGATCGACGGAGACGAAAAAGAGCAAATCGT
GACCTCTCCAGGGAGTTCGAGTCCGCTGTACGTGCGACTTTTGCTACACGCGTTGGAATTATTCGAGCCTGCGCACAACGAGGCTCGAAAGCATTGGCTC
AAGACCGCGACGCAAACAAACGAGCTTCACGTCATCTATGAGCTGTTGATGAAACAATGGAACAAGGTCTTGCTAGCAGACTTGAACGACAGCTACCATA
GATACAAGGCCATGTTTGACGCAGCCAACAACAATGGCATGCACGGTGCCTTCGCAGGGTTCGAGATCAGCAAAACGATGCAGCATGGTGATAGCAATAG
CCCAGCTGCTGATCGAAAATTGACTCGTCGGTCAAGCAAACGAGACGCCGCTGGGGAGCAGACTAGCGCTCACGGGTCAACGCGAACTTCTTCGATGCAC
TCTCCGTCTACCTCGTCATTAAATAGGATGGTTCCACCCGACCCTGCTGAGCTCGAGAATCTGCAGACAGCGATAGAACAACGCGCGTTGCTCGTAAGAC
ACACACTTTCTCTTCTGGCGGTGTCAAGATACGGGCTGACGGACGCAGATTTCGCAAAACTCTTTGGCGACAGCGTCCCAAAGCATGTTTGCCAGCAAAT
GTTGAAGCTGTTGCGTCCACACGTGATGCAAATCCGTCGCCATGACTGCAAGCTTGGCGGTGGGAATAGCAACGCTACCAATATGAGTCTGCAAACTACC
AACAGCAGTTCTGGCAATAACAACAACTCCAGCAGCAATAACCATGATGTGGTTCTTCTCAACGACCTGAGTCATAACCAGCTTCGCTTGATCACGCGAT
ATGGGTTCCTGCGCGATGACCATCTACGCAGTTGCTACTACCGCGAGCTGGCAAACTACTTTGAAGCCATGGACGCGTGTCAGCGACGCATTGACGAGCT
ACCGGTGCAACTGGAGCGGTGTGCAGCGTGGTCCTCGTTGCAAAACGCGCTCGTGGATATCAAGATGTTTCAGTTATGGTGGAGCGAACGCAATCGGCAA
GAGTTTTTCTCGTATTGGATGGTTCTGCGCAACAATTGCTCGATTCATGACCCCGTGGACGATTTCATTCGATCGCTGGATGAGTACGTTGCGCATGAGA
ACCCGAGTGCAGATCAACTGCTTGCGCTTTTTCTCACGATCACCGATTTCCTGCGCGCCTGGCAGAAGATCGACGATTCCAAGGGTGGACACCTGGTGGT
CAACCGTCCAGAGCCTCCACAACTGCAGGAGTTTATCACGAGCCTCGGGAGCTTCACGATCGCTCACTTGTCGGAGAGTGAAGCCAAGAAAACGCAGCAG
GAGATTGATGCGCTTTGCATCCACGCGGACGACGGGTACTATGTTCGTCGGTGGCTCTGGGCTCAGTTTCCACTCATTGGGATTGCATTCGAAACCCGCT
TCTTGCGAAACGTGCTGGCATCTCGCTTTCCTGGAACAGCAGAAGGGTCCAATGCGGCAAACGAGGACTCTCAGCAACAGCAAGCATATATGGCATTTTC
AGCTTCGTCCACGTCATCATCGAGTAATGCTGGCAACAACAACAGCACTCAGCCGCACACTTCTGATGTCCAGTCCATTGGCAAAGGCCATTCCTTCAAT
CCTCAAAAGGGGACTATCCTACCGAAAAGCATAGCATCGATGGATAAATCCAAGAGCAGTCCCATAGCGAAGCGTAAACCGCTTCCAGTGAAGACGTTGC
TGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCGTCAAACGGATGCAATTCGCCCTTCGATGCAATCCCAGAAGACGACTTTGGCGCGTTTGAATTC
CTCTCGCCTGAGAACAGCGAGATCTCGATCGCGTCCGTCTCCAAGCTCGAAGTAAGTGATCCGGCGCAAAATGACTATTTCTTTTACTAGCGAATAACTT
ACACAAGCTCATTCTTTCTCAATGCACTAGGCTCACTTGATGGATTTACGCATGAAGTACGACAAACTCAAGTTTGCGGCCAAGGAGAAGAACGGCAACC
TCAAGACACTCGAATCCAGGCTCCTGGATACAAAGGCTCAGGCGAAAGCAGCGGGTCAGAACGCGTCCAAGATGGACGATCTACTGGAGCAGATTCGCCA
GGTAAACGACGACACGGTGGTCGGTCGACAGCGCAGCGACTACTACAAGTCGATTTTGCGGCACTGCGAAGTCAACCCTGCGCGAGATCCGAACACGATC
GAGAACGCCGAGACCATCGTAAACAAGCTCAAGCAAGAGGTCATCGATCTGCAGCAGAAAGCGCAGGTGATATCATACGAGAAGCGACTCGCGTCCATCG
AGGTGCCCAAGCTACTACAAGTGATCCAAGATAAATCCAAGATCCACCAGACGGCTCTGGCACGGCTCCGATTTCGTCAGGAATTAAACCACCGCGTGCA
CTCCAACTTGATCGCGAGCAAACTCTCGACATTCGCAGGGAGTAGCAATCAAGCACTGCATGACGATGGTAGCAGAAACCATGTCGATGCATTCCACGCG
CAGTCCTCGCCTGCGAAGAATCCGATGATAGGATTTGCCGGCGCTGCTGGAAGAGAGACTATTAGTACAGCAGATCTGCGCAGCTCGGAGTTGATTTCCG
GTGGCAGCGGCCGACGAGCGACGCCGATCGAAGACACGAGCTTTTTGCGCGCAAAGGATAAGCTGCTGCACAAGAAGGAGGCCACGGCAGAGCGACAAAA
GAAGGCAGAATATCTCAAGATGTACGTCGGAAGTGCATACAAAGACGATGGGATCCTGGGTGCGCTGCGTCAAGTCGGGATCAACAAACCGGAAGACGCT
CAGGTGTATTGGCAGGATCAACTTGATCACGCTGCGCAGTTGGAAGGGGAAGAAAAAGCAGGCGAGCAGCGAGTGACGGAGACTCGCGAGCTCCTCGCTA
CGCTGCAAGCGCAATTTGTCAACTTGAAGCTCGGTGGGTGCAGCTTGGGGAACGAACTAGCTGCAAACGGGTGCACAGCGTCTGGGGCTGGTACTGGCAC
AAGCTCCATGATAGGACTCGCAAGTGGTACAAGTAGCGAGGGCGGAGGCGCGTCAAAATCGCACAACATCAAGGTCCTAGAGCAGCAATTGGCAGAGACT
GTGACCAGCAACCAGCAAAAGAAAGAACGCTCAGCTCGCCTCAAGCTTCTCTCCGAGGTACGACGTTATGGGCATTCGGGTTCTGTCTTCATACATGTGG
CTAACTGCGTTATTGATTGTCGGTATGTGGCTCACAGAAACTTCACCTCGGTCTGCTTCATGTTGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNGTGTC
GCGTCTGCGCAACAAATGGACTCGCTTGCGCTCGGTGACTCGATTGAGCAGGTCGTGCGGCTGTTTCTGGGCGATGAATCGCATTTGCAGTCAAGCTCGT
CGACCAATTTGCGCCGCAAGAACAGCGCTCGCGTCATGGGGCTCGCGAATCAAGCCGGGTCGCATCCATTTCTACCGCCAGATACGCGCACAGCCAGTGA
CAAGATCCGCTACAACGTCCGCGTACTGAAGCACCAGACGCGGAGCATGAACCCGTATGTCGGTGACGGCGGTAAGCCTGACGACAACGACGACGAGGAG
AGCGAATCCGATGACGATGCGTACGACAGCGCACTACCAACAACCGGTGGCTTGGCAAATGGCGTCAAGAAGCGCCAGGATATCAAGAACCAGTCGAAGA
TGGAGCTTCACAAGAAAGAGGCCGAGAAGAAACGCGCCGAGAAGAAGCGCAAGGCATGAACAGGCAACAGCACGAGAAAGAGCAGCAAGCAACTGGAGGC
ATCAGTGGTTTTGTGTTTGACTTTTTTCTTGTTTTACCATTTACGTTCTTCTCATCCTTCGCTTCCCAATGCAGGATATTGCGCCGTCACCTCCTCTCAT
CTGCGCGTCCTTCAAAGGCGACTGCCAAAGCTGCTTCTCTTTATTCTTCGTCTTCATCGTCGTCGTACTCGTGAACGTACGTGTAGGTCTCAACTGGCGG
CGCCTCTGGGACGGCAACCACGAGGCCGTCGAGTTCCTTTTGCAAAATGATCTCTGTGCCCAAGCGAGAGCTGCACACACACACACACACGCGCACCTCG
TCNNNNNNNNNNNNNNNNNNNNNNNNCAGCAAGCCGCATAAATATGAACCATCAACAGCACAATAAGGAGCATGTAGCATACTTAGCCGAGCGGTCTTCT
TCCGGCACGTATTGGAGGATGTGGAGCTCCTGGTCATTCGGCTGTGGCAGCTTCGAGACCCACTCGTTCGACACAACCACGTGCGATTGCGGGGACGTCG
AGCCTATTACAACAAACCATTCATTTGTTGTGAGCATACGCACCATCTACCATAGCTCTTCCGATGTCATTTTACCTTCGCCGAAAAGCGACTCGGTGTA
GTAGTCGGCGCGCACGGCACTGTGGATGCCGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGAGCGACACGTTGTTCATCTCGCACGCCTCGCGGA
GCGTTTGGCCCGTACGGCCCTGGATGAAGTGGCGGTTGCCTTCATAGTCGATGAGAACGACGTTCACCCTACACACATCAGTTCACTCCCTTAGTGGCGC
GCTCGCTTCCATACAAAGGGCAAGAATAACACGCACACTTTCTCCGCGACGGTGGGGCCCGAGGCCGCGTCCGCGGGGGCTGCAAAGCCGCCGATGTATC
GTCGCGTCACGTTGCGGCTCAGGGCCGAAGCAGCACGGAGTCTCGCCAGCATCCTCTCGCCTTGCTGATGGGTCTTTGTTCCCGGCGGTCCGCGCGTAGT
AGCCCCCTTCGGAAAACAGGCAATTGCTGCCCACAGGATCACACGGTATGTACCGGTACTGAAACGGTAGAACCAGGTTACCACATGCGAAAACGCATAG
CCCTTGAGATCAAATAGTTTTGGGAAACCATGGTTTGCTGGTGCTAAACACACTGTACGATTTTATGCAAAATTGCGGTTTTGTACCAAGTAGTACCGGT
TTTTTGTCAAAAATAGTAAGCAGTCTTTTTGTGATACACATTAAAAGTATATAAAAATGTAATAATTGATAACTTGTACAAAATTATACATGTCTGAAAC
AAACAATTGAAAGCACACCTGCAGCATTCGATTTACCGTATCGATCTCGCACTCGAAAGCCACGGACGGAAAACACACACCCATACAGACGCGCAGCATG
GCGATGTACACCAAGATGACGTCGACGGGCTCGTCCCTGATCGTGAACCCGCGCACGATCTCGAAGGAGCTTNNNNNNNNNNNNNNNNNNNNNAGCAGAA
GATCGCGACATCCATTGCGGGCGTGATCGCGCGGCACGATGCTGCCAAACTCACCACCAAGCTCGTGCGCCAGGCCGTGGAGAAGGACATCCACGTGAGC
CTGACCAACCACAAGGAGCTGCTTAAGCGCCTCATGCACCAGGAGTTCCGCAAGATCAAGGCTATGAAGGTGCGTTATTATATGTACATCTGGTATATAT
GAAGCTTAGCAAGCGACATAAGTGCTGATGGCTGGTGTAATATTCACACACATACACAGGTGGCCAAGCGCGTGGCGCCGGAAGCCTGGAAAAGCAAAGT
GCGAAAAGAAGCCATACAAAAAGGTACACAACAGCATATATGTATGGTCTTCTGCTAAGTTCATTGATACCATTGATGAGGTTGGATGATGCCTAATGCA
CGAGCAGGTCTCCGCCACGTGTACACGACGCTGCGCGACGACGAGAAGCTCTTTGCGCAGTTTGGGCTGCATGCGCTGCAGACGCTCTACGACCTGCAGT
GCGTCGAGACGGACGAAACGCTGCGCATGAGCGCATTGTATGCGCGCTTGCTCGGGGCGCTGTGGCTAAAAAAGGAGCAACAGCACGCGTCATGCGACTG
GGCGACTGGGGCCATTCCCACTGCAGTGCAGGCATGTTTAGCTAGGGAAAAGCATTCGGCCCTGTGATCGTTTATGGAAGCCTCATGATATATGGTCAAT
TACGCAATGACAAGTTTAGGTCGTGGAGATGCTCAAATCGGTGTTTATTGTGGAACGACTGGGCATCAGCCATAGCAGACGCGTGGAGCTCTTGGAGTTT
TTCGACTCTGCGCAGCCAGTCTATTCGCCAGTGGTACGTTGCTCATTGGAGTTCTGCGGATTTGTGTTATCAACCTGCGACGACTAATGGTATTTTGCTG
GGCCTTTTGTGTAGCACTACTTTGGATGGAATCCTGCTGCCGGTCCTCCCGTTTCGGATGAATCGGGCACGTTGTACGAGAAAATGGCCAACGCGCTGCT
TGGCACGTACGTTGCCCACTTGCTCAATGTACCTCTTGGGTGCACGTTTGCACAGGTAAGTGTTCTGTTTTTCTCTCTCTCTACGTTGACGTTGGATGAC
TTTGCTTGTGTGAATGACTCATTGTTTTCTGCTGTTGTTGCTCTCTCTTACGACATGCAGCTCTTTCAGTATTTGCCTGGCATGTATCCGTACAAAGCTC
CCGATGAGCTCTCTCCCAAGGCCTATCGAGACCAAGTGCTTTTGGTCACGACCATCGTCATGGTCGTCACGAATTTTGGGAGCTTGTGCTGCGAACCGGT
ACATGCTTATCCACACACTTGCAAACGCTGGAATGTTCTTACGAGCTATTTGGACTCAATACTGCACGATTCTGTCTTGTTGTAGGAGTTGCTTCCACAC
GAGTACTTTTTCCTTCGCTACCATCTCGTCTACCATCTCGCGCAACAAGATATCGTCCTCGTTGGCGAGACCCTGCGAGTACGTTTGATGTCTATGATTT
TCCATGCATCGGCTTAAGCCATGGTTAACTTATACTTTAGCTCTTTGTGTTTCTTTTTCTAGGCTTTGAAATGCTTCGAAGGCTCGGAGAACCTCGTGCA
AGTGCGTCGTGGTATGGCGTTTCTACTGTTATCTCAGCAAAAGGATGGTTCTTGGAACAACGCAATTGAGAAGGGGGTCGATGCGGCACAGGCGTATTTC
TCGACGATGAATGCGATCTGGGCGCTCAGTGAGCCCAAGATGATCGGCTTTGCGCCATCGCACCCGGAGATCGCGCCGCTCCTCGAGGTGTATGTCAACA
CGGACATCGCGCCTCACGTACGTTGAGATCTGCTGGCATTGGTACCATGATGTGTTGATCGTGTATGCTAACCTGACATTTTCGTGGTTGCTACTCATAC
ATAGCTCAAGGCTGCTGCGACATCGTCAACGGCTGCAATCCCTAATAAAAGCGCGAGTGCGGAAGAAGCAACGCCATCCTCTCCGAGCACGACTGCCGCT
GCGCCGCAATCCTCCTCTAAGCCACCATCGTCTGAGAACGCAGGTTCCGAAGCCGCGAATGAGGCCACCACGACTTTCGACTCGGGCGCCTCGGAGGAAA
GCCTGGCGACGCAGGTGCGCTTCCTGCAGGGTATGCTCGAGAAGGACGGCGGCAACGTCAAGGCAGTGTCGGCGACGCTCGCGACCCACGTGCTGAACAC
GCTCNNNNNNNNNNCGGGTCTCGTGCTCAACGTCGAAATCCTCAAGACGACGGGCGTCGGCCGCGTGATCAACAAGCTGCGCAAGCACGCATCGCCTGAG
GTCGCCAAGAGCGCGACACAGTTGGTTGCGAAGTGGAAGAAAGATTTGTTATAGTGCC