Description :
From Genome Similarity Track
Location :
Scaffold_121:43311- 44827
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_121-fgenesh-gene-0.13DnaJ homolog subfamily A member 4.

Sequence
1516 bases(100 bases per row)
CCTTCTTGTCCGTGTAGATGGAGGCATCTGCCGGCCAGAGTGCTCCCCAGTGGGCCTTGCGCGACGCGCGATATACTTCGCGGATGTGCTTGCCTTTCGT
CACACTGCGGCGCTCGAGCGTGCCCTCGGGGGTGCACAGGTCCAGGTGCACGTGGCGAGTTGCAAGTAATGGGCTCCTGGAAAACAAAATGCAACATTGT
CAACACCCAGATCCAACCGAGAGGCTATGTATGACAAGAGCATACAAAGGCGCTAACATACCGAATCATTCGCGCGAATCGCTGCTTGGTGTCCTTTTCG
TCCGCTCCGTTCTTCTCCATGATCACATACGAGAACTTGGATCCTTTCTGGCCGTGCCATCTCTTCGGCGTCATCTCGCGAGGGCGATGCACCTGCGGCG
AGCGCTGCACAAAGTGACACCAGGTGCCACCAGCAGCTGGGCACTTTTGAATACACACAAAGTAAAACCTCACAAAGTTAGATGCCATGATGCATCAGGC
AGAAATCGCATGTCCACACCAAACAACATACCTCAAAGTGATGCGGGCATGGTGCAAGGATCTTGACGGTCTCTTCTTCCTCTTCCGCCACCGAATCCAA
GATGAACTGACGCGCAGAGCGCACGTGGTGGGACCCCCACGGACTTCCACGATCCACGAGCACCATACAGCCCTTGTCGCTCAGAAGCTCCCACAGCGCC
GACATCACGGCCACACGCTCGTAGTCGTTCGTAATTTCCGAGAGCACGTAGTTCAGCACGATTAGGTCGTACTTGATGCCGCTCTCGAGCTCGCGCTTCA
TCTCCGACATGCTGCGGCGAACGCTGAGTCCTGGAAAGCCTTCCAACACGACCTCCGCGGCATCCACCATCGACTGGCTCGGCTCCACTACTCGGTAGCG
GGTGATGGATTCGTCATAAAACTCTTTCGCGACCCAGGACGCTGTACCTGGTCCTGCACCAAAGTCCAGGACAGACTCGGGCTTAAAATCTGGTCGCTGT
TGCTGCAATTGACGGAACACGTGATGAGCGCACGCGTAGGTGCCTTCCACTTCGTACGCCATGTACGCCATCGTCTCGGTCGGTCCGTACAAATAAGCGG
GGATCTGTGCATCCTTGTCTAGCGTCCAGCCGATCGGATTCTTGTGCATGTCGAGCGGGATCTGGCGCGTGTTCTTCTCGTCATACACGTACTTATCGCG
CAGCTTTTCCAGCTGCGAGTGCGTGCGTCGCTTCACGACGGTCGTGAGGCGACGAAGCAGCTCCTCAGGCATCTCGACGCGCTGTTGGATGCCGTTGCGC
GTCGTCTCGTCGATGTTCGACACGATCTTCATCGCTTCGCGCACTTCGCTCAGGATTCCGCCCTTGCTGGTGCTGCCATCACCGGATGCTTTCGCTCGAC
GCAGGCGGCGAGAGCGACGACTGGAGCCGCTGGATGGCACAGTAGCAAAAGTGCTGGTTTGTATCGCGTGTGCGGCGTTGCCGACACGCAGCGCGCTTGT
AGGGCGCAGCGCACGC