Description :
From Genome Similarity Track
Location :
Scaffold_74:43311- 44652
Transcript NameFunction/comments
Phyci_232875Rab11 family GTPase putative
Phyci_232811unnamed protein product

Sequence
1341 bases(100 bases per row)
CGTCCCAACAGAGCTTCCGAGCGCCTGCCAATGGGTCCAAGAGCGGATCCCCAAGTGTCGTCACGGTAACACGCGAGAGCTTGCAGAGGCAGCATCAGAA
GGCGTACCTCGCACAGAACCAGACCCCGCAGTGCGGGGTCTGCACATTCAACTGCACCATAATGTAGTCATCGAGCAGACGATGGACGGCTTGCCTCCTG
GTCATCAGGCCGCGGGCAACCCGTCCTTTTCCCTCCACCAAGCCAACGTACGTCAATTCCAGTCTGCATGCTGACCCAAAACAAGATGAAACCAAGTCAA
CGACTGTACGGAATAGTCGCAACAATGAAGATGAAGGGTACAGGGTCGAATAGAAGCAGGCTCGTTGCATTTTCAGTTTAAGGTCGTGCTACTGCTTCGG
GTGCATGCGGGCCGGCAGGGCAGCGATCTCTTTCTCACTAAAAAGTGCCGACGAACCTTGACGATAATTTATTCCCCGAATGTTTTTTTGCAATGTTTCT
CTATGTAGGTCCATACATGATGGTTAACTAACGACGCACTGCCGCTACTACCGCACCACTATCATCCACTACGCTATTTACTTCGAGCGGCGAGCCACCA
AGAACGCGGCAGCGACCGTCGCAGCGGCGAGCGCAAACGTGGCCAGCTTGCACTCAGTGGGGGCCGACGACCACAGGCTGAAGCAGTCGCCGCAGGCCTT
CTGGTTCTTCTTCGCAATGGTCTTGCGGATGTGTTCGGCCACGGTGGCGCTCGAGTTGTTGGCAACCGCTAGCCGGGTGGGGAGCGACTCGAGGGACTTG
AGGATCGGGTGCTGCTGGATCTCAGTCTCGGCCACGCCAAGAGCCTTCGACACAACAGGCAGGAACTTACCGTAGTGCGCCGTGCCAACGACAACCACGG
CCGAGTTGGGCTTGTCGGTAAGCGCGTCCTGGCCGTAGTGCATGGCAGCAGCCGCGCCGATAGCGCTGTGCGGATCGTAGAGGTAACGGTGCACCTTCTT
GTACTCGGCGATGGTGGAGCGCACCTCGTCCTGCAGCACGGCGTACGAAGCCATCTCGTCTTGCGCCTTGGTGAGCAGCTCGCCCGAGATCGTCAGCTCG
TTCGTCTGCTCGAAGCCCTGCATCCAGCCGCGCAGGATGTCGTGGTTCTCGCCGCTCAGCGCGAACAGGTAGCGCTCAAAATTGCTGGACACGCAGATGT
CCATGGACGGCGAGATGGTGTGTTCAATGTCGCGGCGGTGGTACTTGCCCGTAGAGAAGAAGCGGTGGAGGATGTCGTTCTCGTTGGTGGCCACGATGAG
CTTGCCGATGGGCACGCCCAGCTTCTTGGCGTAGAAGCCGG