Description :
From Genome Similarity Track
Location :
Scaffold_170:4331- 5860
Sequence
1529 bases(100 bases per row)
GAAGACGACCTGCGCGAGAATGATGAGCAGCACGTACGTGTCCATTGTCAATACAGAAACTGCGTCTTGCGCAACGCTCGCGCGCGTAGCCCTTGGCGGT
GTCTTGTACCAATCGCTGCGATACGTGCCGCTGGATTTTCCAAGAGAGCCAAGCGATCACGATCGTCTTCGTCCTTTACCCTGTGTCTTGTATCCTCGTT
CTTTCTGTTGGCGTGAAGCGAAAGCGCATAGCCGTGGAGAAGGGTGGAACGTCGCTATGGCCCCCATCCATCTTCATTCACTTCAAGTGACTATGGGTGG
GCGACGTCGCAGAGCTTCTCTCAGTGTGTGATTACGTCGAGTAAAAAATACGGACTTGTCCCGTATGATACGATTTATTTACGAAGTTGTGAAAAGCGTC
CACAGGCTGAGCAAAGCAAGCAGCAACACGGTGTAGAGTCCGATGTTTACGGAATCAATCCATACTGGTACCAGATTGCCATAAATATGGGCACTGCTCT
TTGAAGTCTCCAAAATCCGCAGCACTTTGTCTTCAAAATAAGGTAAGACATCGTTTTCTTCAATCCCCAGACGCGAAAGCCCGAATCAAATGTGTTGCAA
CATAATATGTAATCACATCATGCAGCCCCATCAATTGCAAACTATGTAAACATTTGCCAAGTCTGTGATATCAATACATTGCCTTGTGGTTGAAGTTGCT
GCAAGACCCAAGCAGCAACTCGCCGCCGCCACACACACTTCAGACGCCACTTACGGCAAGTCGCGTGTGATCCGTCTCGAGACGTCGTCAGTTCGATTGC
AGCGGTGCCGAGTCTTGAAGGCCTTACAAGGCAGTGAGATCGATCCTGAACGTCTTGAATAGAGCTACAGCAAGTCAACCCAGCGTTTTTTTCTTCTTTT
TTCTGATCTCATGAAGTACTTAATGCTGAATTTGCTCACTATTAGTATTAGCGATCACTCCATCAATCAATCTGACTTCAAGCAACTCGTACTGCGCACC
TCCGTCGTACAACCAGCAATGTGATCTTGAAGGTGCCTCGTGTTCGCTGGTGGGGATCATCGCGCCCAGTATGGGAATAATCGGGTACATGAACCGCAGA
TGCGAAACTGTAGCAGCACTCTGCGTCTGGTTTCCCATGCGCAACATCGCAGTCATCTCACTCGTCTCCATGTCGCCATTGTCCTGTTTGCCTTCAGGTC
TTCCTCCCCACCACCCTTCTGATTTCTCATTCGTGTGCATGGCTGAAAAATTTCGAGACCTTCTCAGCTCACAATACCGACCATAAAGAGGTTTTCAATG
ATGCAACTTCGAACCTCTCTACCCTTCACTTAGTACACATATCGTATACTACTCGTCATAAAAAGGTTTTAGGTTGGCGTATGAGTGTATGTAGCTGCTC
ATGTGGGGGCGGCTCTATAATTTTTCAGGGCCGCGACGGAACAAGGCCGGAAGAACGAAAGAAAAGAAAAGCACTATTAGCAGCAGGAAGACCACACGCG
TTCTCTGTGGTGGCAGCGGCGGCGGTATC