Description :
From Genome Similarity Track
Location :
Scaffold_425:43301- 46719
Sequence
3418 bases(100 bases per row)
CCTTTCGACAAAAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCA
CACTTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGGACCTCTCCGAAGTTCGTTGCCATGATTAGGAGCGACTTCTCCCATATGA
ACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAAGCATCTTCGGAATGGAGGTCCTGCAGAGCCTGGTGGTGTCAACACCGTACGAGCAGGGGCTCAT
CGCGCATGTGCGGGATAGCCTGCAGGCTCCGGCGGCGGAAGCCAATCCGCCTCACCCGAAGCCAATACGGCTGAAGTTTAAGCCGTATGAAGGGAAGGAA
GGCGAGAACCTCACTTTTGGGTCCAAAAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAGCTTCGTGTTGCTTTTGTACTCTCCAACCT
TAGCGGCCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTC
CTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGCACACAAGGGAGACGTGAGCTGCACGAGTACGTGCACGCGATGCGGGAGCTTA
TGGCATCCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGT
GCAGTCAAGCACCTTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCC
TTGTCGGCTCCCGGTCGAACAAGCCCCAACGAACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGTTTCGGCTGCGGGAAGATGG
GCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTTCGCAGACGGTCCTCCCCCAAGCCCGTCCTCAAGGGTCGCTAACAGAAGCCATGATCCCGGGGGCA
GGGGAACGCCGAGAACCAGTAGGGGCGGGGCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTG
AAAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGA
TTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGAGGCTTTGAGAGAAAGCAAGGGCATTGGGACGGTG
TCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTTCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTG
TTCTCGATATGGATTAATATGATCCTGGGCATGACCTGGCTTGAGAAGCACGAGCCCTGAATCGGCTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTG
CGCAGTCCGACAGAGCATTGGTGAGTCATGCTTCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTT
GGGAGTCGTCGACGTATATGACGCCTCTGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGACCAAGTGGGTAACTTAGGTTCACAGGCGGGT
AACTTAGCTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCAACTCACGGTCGCCCAGACCTTAACTG
AAGAGGAAGACGTCGGATACGCTTCCTGTATGGGTAGCACAGTGCCACACGCGGTCGCTCAGACCTTAACTGAAGAGGAAGGCGATGAACACGCTTCCTG
TGTGGGTAACATAATGCCACACGCGGTCGACCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACGGTACCCCACGAGGCC
ACAAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGT
CGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTTGGAATCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGAAAGAGTGTTATCACATCTT
CGATGGCGAGACCGGTTTCCCCGTCAAGGCATCTGGTGTCCACTTGGAACCTTTGCCCAGAGGTTGCAGAGATACCTGACCCTCGAGGAAATGACGGTCG
AGTCTTTCTTGGCCAACCTCAAGGCTGGAAGGTTGCCGAGATGGTGCTCATGATACCTGAGACCACTCGGGAGGAGCTGAACTCCCTCCTCTGTCTTGGA
CGAGAACGTCCTAGAAGACCTAAAACAAGCAGCGTCAGACGCGCTTGGGCTATGAGATCCTTAAGAGCCCCAAGGGTCCGGTGTATCTTCGGTGACGGAG
TATGCAGACATGGTGAACAAACACGCACTGACCCAACTCCCACCGAATCGAGGTGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTACTGTGTCA
CGAGGCAATGGCCTCTCCCGCGCGAACAATGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAAATCCCCCG
CACTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAGACAC
CAATCCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGAAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACTAGATCCTGATGCGCG
AGAGCGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGACATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAA
TCGCCTGGTGACGCAATTGTTCCGCGCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGGCGGCC
ATGGAGGTGCATCTAGGACACCTCCATCGAGTGTTGGACGTAATGCGAGCGAACAAGATCTACGCCAGCATCGACAAGTGCGTTTTCGCGTCACCAGAGA
TTAACGTCCTCGGCTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGTTCAAGGCCACCACTGTCTATGACGAGTGGCCGACGCCCCGATC
CCAAAAGGAGCGTTGCGA