Description :
From Genome Similarity Track
Location :
scaffold_757:4330- 9814
Transcript NameFunction/comments
Pl_102559hypothetical protein PHYSODRAFT_443029

Sequence
5484 bases(100 bases per row)
CAAACTATCACAAAAAGTGGGGTAAGTGGATTGCTGGCAAAAGTATTATTGAAAAGGTCGGATGTCTACAACTAGAAGAGCTCGTCATGGCGGATCCTGA
AAACGAGGAAAATTTGCTTAAGCTGGGTCTTCGATACGCTAGGTGCTCGGGGACAAGCATGCAAGCAATTTTGCTGCTAGAGCATGCAGCACTATTGCAC
AAGAATGCTGCAGGAACGCGTGAGTATTGGTTCTGGCTTGGCTCAGCACATTTGGATATCTTCATGCGCCATCGAAAGTACATGTCGGTTGCACGATTTC
ATTTGAACAAAAGTCTTCGCGCATTTACAAGTGCGTTTGCGTATTTGGAGAGTTTAGCGGACCCTATACTGCTTCTTCGCTATGCTATTGGGCTTTTCTG
GCACAAAGGCGATGGTAACTTGGAGAAAACTCGTGATATTTTTCACGAGCTGTTCTCGCAGTTTGTGAGCTTCTGCGATAAAGACCGACCAAACTTGCTG
TTTCTCCAGTTTCAAGTATTTCATCGCCTCAAACTCTACGTAGATGCAATCGATTGTATCACCAAAATCATTCACGAAAGCTTGTCGTCCCAGCCAATGT
CGACAAGTGTTCCTGTCCTCCCTTCGATAGCACACTCTACGGTTTATGATGCGGCTGATTATCACTTGATGCTGATGCAATGCCAACAGGCCAGTGGCGA
TTACGTGGCTGCAGCTCAAAGTCTTGCTTCCGTTTTGAAGCTCAAAAGTATGCAGCAAGAAACCACGATGCAAGATGAAGAGTACTTCGATCTGTGGTGT
TCCCTGGCGGGAAAGTGTTTTCACCACGAAGACTACGCGCTCGCATTAGAATACTATGCGATTACCTTGAACTTCGCAAAGCAATCTCAAGTTCTGGCCA
CCATTCACTATAATATTGGTCTCTGTTTTCAGTCTTTAGGTGAAGACAACAAATGTGTGACGGAGTACAAGCGTGCACGCACCGCGAATCGCCATGTGCC
ACCCTTAGTTTCAGTTGCCGAGCTTGGTAACCTGTATGACGAGCGCTTTGCAAAGCTGCTTCAGAAATCTGTCGTCCAGACGATTGAAGAAGTACGTGCA
GAGCTGTATGGTAAAGCTGTGCGACGTCTTCAATGCGTTTTCCGCCAGAGTCGAAGAAATGTTAACGTCGATCCTGATAGCAACAGCTCGGGTGCCCCGC
TAACAAAGATGCCCAGTTTGTCCAAGCGAAGATCAAGCATCACAGCAGCTCGAAACCCGCCTACTCTTGTTAAAATTGTCGATACCACCGAAGAAACGGA
GGGTATCGAGGAAGATAATTTTCGGCAAAACATGGTTACCACTAGTGACAATCAAGTTAGCAGGACAGATGAAGAAAGCACGGTTGAAGTAGTCGAGCGC
CGGCACCTATCTTTTCTTGCAAGAAAGCAGGTGGTAATGGAGGAAATGACCGAGCTGCTCACAAATCCACAATATCGTGGCCGAGAAACATCGCCATCGT
TTCGTCCCAATCCACGATTCAAAGCTGCAGCACAAATGCGCAGTGGGCTCTTATCGCCCGAGAAGGACCGGCTGGACGCACGTCGAAAGCAGTCTATGGA
GACATATCGCCAGGTAAGCCACTTTCGTGAGCGCGTACTTATCTGCTGTAACTCACTCACCCTTTGCTTACTGCTGGTAAAGCTCGGCTATGTTTCATCA
ACAATGCCATGGATCGAGTTCTGGGAGAAACTGCTCGCTTTGGCAACAGAGCTTTTTGAGTCGCGGCAGGCTTTGTACGGAAACATTGCACGAATTCGAG
GCCGACAGCCTTTAGTGACCGACGAAGTCGCCTTCTGTGCTCTAGCTGAAAGTATCGGAAATGTTCATGAAGCAGCCAAAAAGTTGCATGATGCGTCGTA
CGAGCGCGAGCTCACATACGTGTGTGCCGTCATCGAAGTCGCAAAGCGACTTGAACGAGATTTCCCACTGGATCTGGCACAGCTCTCCATTAAATCTCCA
CAAGTCTTGCTCCCTACAATATCGTCACCTAGGGCACATATTGTTGCCGCCCATAGTTCACAAAGTCCTACTGAAGTAGTGGCGTCGCACCGTGTTGTGC
TACCACCGTATTCTCCAACTCGAGCAACATCTGAATCTCCTAGCTCCAACCCGAAAAAGCACCTTCGAATGAACCAGATGCTCAACTTGCATTTCCAGGA
ACACGTTCAGAACCAGGAAGCAGCAATCGCAATTGCTGAGGCCACAGGAGGATATGTGCAACCCGAACATCGAGCTGAGAAGTTAATGGTGCTTCAGGAT
TTCCGGTTAGCCAACAATGTTCTCTTGAGTTCACAACTGGCATTTGGCAGTGAGAAAGCAGCCATATGAGGAAGTCTTTATTATCAATTGTCTTCAGTGA
GATGCTAAACGCAGGTAAACATTATTGTAGGTGTGAATATTCACTGAGTGAACGCGAAGAAGCTTATTTCAGCTTCGTTGCAACCTTGTGAATCCAGTCC
ACAAGCAGTGGGAACAATGCGGACACACTGTCGTTGATGAGGCCGAGGAAAAACTGTTCCGCTTGCTCGTCAGTCAAATCCAAACGGAACTTCTCTTCGA
CCTTCAGCAAAGTTGTAGCAGGATTCGCTGACAGTTCTTCAATACCAGAGTCTGCCATCAGACTAAGTAAGTTCAAAATCAAATCAGCACTCTTACGCAA
CCAATTGTACGCTTGACAGCAGTACGTTGTGAACTTCTGGTAATGCTCGCTTGTAGGGCCACCCATGCCTTCTACCATTTCCTTTGTCAACTTGAATGGA
GGCGGGTACGGCTTCGGATCCGCGCCGAAAACAAAACCGAAATCAATGTGGAACAAGTGACCTTGGGCCTTCATCATCAAGTTGTCCAAATGACGATCAC
CAATTCCCAGCAAATACGTTAGTACGCAATAGCCGGCCACTGATTTCACGTAAGTACTGAGAGCTTCGGGGGCGATTCCAAACTCCGCGCTGGGGTCCGG
GTTGTGTTTACGCAGGAACCCCACGATCTGGGGCGACTCGAAGTGGGAGACCACATACGAAACGGGGTACGAGTCTTGCACAAATTCCATCAAACCATCG
TTAGCTCCTGTTGCCAAGATACGGTAAGGAGTTAACTTCAAATCCAAGTTCACTTTTTTCAACAATCGGTCCATCAGAATGAACATTTGCATGATCAATT
GATCTTGACGAAGATCGTCGCCGTTCTTCACCATGAATTTGTACATCGGTCCTTCCTTTTCCCGGTGCAAGTAACTAATCATACGGGTCGGCAGCGACTC
ACGCATTATGTTGGAGTCGCTTCCACCGAGCATTGACTGACCCAGATTCGGTGCATGGTGGCTCTCGCCTTCAGCAGTGATCATGTTGTGGTGCTGATCA
GTCGGGGGAATTACCGTCTGGAATTGAATCACAGCCGGGTACATTGCACTCTTAAACATCTTCGCCGAAGAGGCAACAACTCCGCTCAAATGTACTGTCG
GGTCCAGAGGCAGAGAGATCACAGTCCCCTTAGACCACGGGAACTGCTTGAGGAATTGCCGCAGCTTCTCCTCCTTTTGATCTTTTCTTCCCTTTTCTTC
GCGAGCTTTGTTGTGAATTGTCAATATATGACTCATGAAATCGCGCTGTGCCATCAGCATGTCGTAAATAGGCTTTTTTTCCTCCTCTCGCTTCATTTCA
GTCAGCATTTGGTTTAGCACAGTATGGAAGATCTCGGAATCGTTTGTTTGTTCGCCAGCCTCCACTTTCAGATACCAGTAGAAATAGTTAGCCATCTGAA
AATTTGTACTCGAGCGAGCAATCAGGAATCGAGCCAATGGACCAAGTTCACTTGTAGATCCGTCAGTACTACCGTTTTCATCCCCACTCATCGCTCCGCG
AGAAGACGTGATGGGTACCCCAGGCTTCTCATACCGGAGTGCCTGTACTAACTGTAGCAAAAAGTCAAGCAGATCCTCGTTCTTGGCTGTCGCCAGAGTG
GACACTGCAAAATGCCGCACAATTTCGTGCTTAAACTCTTTTTCGCGACCCAGAAGTTTTAGGGCGTCGGCAATATCAATTTCGCACCACTGAGATAGCA
GATCCGTTGCTTGCTTCACCTCTAGTTCGTCTTTCCAATCAACCGAAAGGAGAAATTTCACCACCGCCTTTTTGTTGTCTGTCAAGGTGTAGCGGAATTT
CCATAGCAAATCTTTATCTTCATTCTTCAAGTTGTCCGTCGGTGTTGCCAGCAAGAGCTCAATGCGAGCCTTTTCGTCACGACTCGGCTTAAGATTGGGG
TCGATCGAACCACGAAGAATATCGCGTGCAAGACGACGATACTTGCGCTCAGCCGGGTTATCTTCATTAAGATCTGGGTCCCACACCGTCACAAGACTCG
GCAGCTCCCTGGATCCAGAGGTTGTGGTCGTAGCTAGATCGTACGACCCACTCAGTGTGTGCGAGTCGTAAGACTGACCCGAGGACGATGCAGTGCTGCT
GTCGTAATTCATCCGTCGAGGTCCCATGTCTGCCGTGTACGACGACGTCAGATTGCGTTGCGAGTAAGGCTCCTCCTCGTACACGACGACATCTCCAAAG
TATGGCATCTCGAGCCACAGCAATGCGTCTTCACGATACGAGCAAAATGGTCCGAGTGCATCTCCCCTCGTCGGTGGTTCACTGCCTCGTCGAATGCGAG
CAATGCGTCGGTCCGTGACACTGTCCATCCACTCGTTACGTGCGATCTCCTTGCGCTCGTACTTCTCGCGGAGCTTGTCCAGACGGAAACACTCCTGTCG
CACCCACTCCTCATCGATCTCCGATGGTGTCATTGTGTTGGGGGACGAGTCAGCCTCGCGTCCCTCCCAAATGCGGAGACATTGTACGCCGTCACGCAGT
ACACCCTGTTTGGTGAAGAAGGAGATGGTGGAACCGCCAATGGGTACCCAACCCACGCCCCAGATCGTGATGGCCAGTAGTGAGTTGCGCGAGAGGTCAC
GGTAGCGTACGGGGAAGGAGATCCACTCGTTCCAGTAGATGGTAGAATTGCTGCACTTGGTGGGGCTCTTAGAACTGGCAGCAGCATAAAACACAGAGTT
TCTCAGCTTCTAGAGCTCGGGGAGCACTACAAAAGACATCAACAGAGAGGTAGTACGAACCTGATCACCATGGGATGCAATGGGAGTCCATCGGAGAACA
CCTGAGCGGTCAGGAAGATCTCGCTCACGGGCGAATTGCGCACTTCAGAAGAAGTGCCTGCTAGCTGTTCCAGTCCTGCGAGTGGCCCCTCGGACACGGC
GCGTCGAGGTGCATCGCCGGTGACAGAGCAGCCTAGTGCTGGCGCTAGATGGCCCCTCGGACACGGCACGTCGAGGTGCATCGCCGCTGACAGAGCAGCC
TAGTGCTGGCGCTAGCTCCACCAGCGAGATCTTGACGGATATGCCTGTGCTCACACCGCTGCTCAGGTAATAGCGGTACTCCTT