Description :
From Genome Similarity Track
Location :
contig_25:432975- 436927
Transcript NameFunction/comments
g5876.t1hypothetical protein
g5877.t1hypothetical protein

Sequence
3952 bases(100 bases per row)
CATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGC
CTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCAT
GAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACG
GAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGACTC
GAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGACGACTCCGCGGGATGGAGATGACTCTGCTCCA
TCCGCTGTTGTTGCGGCCTCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAAT
CTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCG
GGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGT
TGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACTTGAACGACTG
CACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCGGAGCAGTACGCATCACCGAGCGGGACGT
CAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAATCGCAGCACT
TATCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTC
CTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGA
CCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGGGGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGA
GTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGCAG
ACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGGCGTTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGT
GACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCG
CCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAA
TGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAA
TTACGGCGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTT
CGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCT
TGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGC
CTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGA
ACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTG
CGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACC
ATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATAC
CAGTCCTCCGCTTGTTGTCTTGCGGAAGACTAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTG
CGCGTTGGGCGCAGGCTTCACACACTGGCATACCTCGCAAGCACGAACGTACTTGCGTATCCATTTGTACTGGTGACTCCAATAGAAGTCACGCATGAGA
AGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGAGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAACTCATGATCATCCGGCACGACAA
TGCGATCTGTGTTGGCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACG
AGACTTGTCAGAAGGTGTGGAGAAATACTCCAACAATTGCTTCGCATCCGCATCATGCGCGTATGTGGCCTTCACGTCATCTAACATGGACGACGAGAGT
GTAGTCGTCGGCCTCTTGCACCTTCGTGATCGTGTTGCATCAATGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTG
GTCGGTCACCGCCAAGATTGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCTTCTTTCTTC
AAGAGCTGCGACAGCGGGCAATTCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTG
AAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCC
GAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTGTGCATCTCCACATCCGATTTTCCA
TTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTG
GGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGAT
CTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCATTTTGAGGTATCGGCGTCTGCGCCGGT
ACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCACCCGCCCT