Description :
From Genome Similarity Track
Location :
Scaffold_78:43281- 45975
Transcript NameFunction/comments
Hyaar_Emoy2808298hypothetical protein

Sequence
2694 bases(100 bases per row)
CGGCTTAAGGAGGCCAACGTATAACACGGGGTGTGTACGCAATCTGCGCGGTAAGCTGGGCGTATACACAAGACCCTTCTTGGCCACGACTGTAAATGGT
CCAATGAAGCGAAGACACAGCTTAGTCTTAAACACAGCAGACACTACATTTGTAGGTAGGTTCTTAGCGTTTAGTAAGACTTGATCACCGACCTCATAGC
TTATAATACAGCTTCTGCTTTTAGCATCCGCTTGTTACTTCTGTTTGTCTTGGCTATTAGCCATTGCGTCACTCACATGTCGTAAGACATTCAATCGTAT
TGTTAAGAACGTGCTAACCTGTTTTTGAATAGTAGAAGGGCTGATATCAGCAAGCCGATCGGATATATCTCCCCCACCAAGCCCTGAGCCACAGAGTAGT
AGCGTTAACGGAACGCGGGGGGGGGCGGTTGGGCCGCTCACGTAAAACGGAGTATAGCTTACCGAGGCATGGACGGCATTGTTCATATCGAAATCAACAA
CGGGGAGTATTGAGCTCGAACACCGAGGCGTCTCATCTCAGCACACACGCTGCGTAAGACGTCACCGAGGACGCGATTGACACGCTCAGTCTGACCATAG
GTCTGCGGATGATCCGTGATAGACATTTCTAATCTGGTGCCGAGCACTTTGAAGATGGCCTTCCTGTACTTGCCCGTAAAACGAGAATCGCGGTCAGAGA
CAATTTCCAGTGCCAGTCCGTTTTGGCGAAACACGCGATCGATGGACAGCAAAGCTGTACCTTTACCATCAATCGAATCCGGCACAGCCGCTAAGTGCGC
CATTTTGATCAAACGGTTGACAAAGACCACAATACCTGTGTTGCCATCCGAATCCCTCGGTAGGCCAATCACGAAGTCCATGCTGATAGACTACAAACAC
CCAGAGAGTACAGGCAAACTAGCCAGCGGCGCAGTCCCATGTGCCAAGGGTTTGATCCGTTGGCACGTCTCACATGTGCGCACAGAAGTGCAAACCTATT
TATAGAGTTTGAACCACCAATAACTCTGGCTAACCAAGCCATTGGTCTTCTCACGACCGAGTTGACCGCTAATACCTGTGTCGTGGACCAAATAGAGGAT
TCGATAGTTCAGTTCTCCATGATGAGGAATAGCGATACGCGGTGCATTCGCAGCATCCGTGCGATAGCAAAAAAGCCATTATCGATAGAATATCGATGTT
GCCTCCTACGAGAACGTACCGAAAATTTAATGTCCAATTCCTTAAACTTATCACTTCGAAGAGCACGTATCAAAGCTACACATTGTTCATTCGTGGCATA
AGCTGCACGGATTAAGTGAGTAATTGATGACGGCAAAATCGTAACATGAGCAAGCTTATAGTCGGGCCGTCGTGACAGCGCATCAGCCAGCGTATTTTGC
TTTACCAGCTTATACATCACCTCGAAGTTATATTCTGCAAAGAATGAAAGCCAACGAGCCATCTTCTGCGAGAGGTGAGGTGATTGGGTCGCCGTGGGTA
AAGACGCATGATCAGTATAGATTAATACAGGATTAGAGCCAAGCAGAAGGACTCTGTACATGACTAGAGCATACGTCATAGCAAGTATCTGCTTGTCGTG
AACTGGATAGTTCTTTTGAGCAGCTTTAAGCTGACGAGATTCAAAAGCGATGACACGCGAGCGTCCCTCAACATCTGATTGTAACAGAGCATAGCCAATG
GCAAAGTCAGATGCGTCACAGACAACACTGAAAGGCCGATCAGGATCGGGCAAAGCCAGTACTGGCGTATGAAGGGGACTTTCCTTAACTTCTTGAAAAG
CATGATGTTCGGTGTTACCCCAACACCGTTCCACATCCTTCTTAAGGAGATTGGATAATGGACGAGCCATATCAGCATAATTCTCGCCATACTTGTACAA
GCAGTTGGCAGGGCCAAGCCATTTGCGCAGGTACCTTTAATTCTTAGAAACTGGCCAATCCATTATGGCCTTCACCTTTACAGGATCTGCCCGAAAGCCT
CGCTTCCCAATGAAGCATCCAAAATTGGGATCTCATCCGCACCAAAGATACATGTTGATGCACTAGCATAGAGATTGATAGTGCGCATGCACTCGAGCAC
AGCTCATAAATGGTCGATGTGGTTATTTACGTCCGACGACCCTGTTCCGCCCGACTATGGACAAATTTTTCATCGGGATATGTTTGCGCATACGTACGGT
GAGGGCGAAACAATTGCGTCACCAGACGATTAACCGTAGCCGGGGCACTGGAAAGTCCCTGGGGTATAATCAGCCGCTCCCAAAGCATACCGCTTGGAGT
ACTAACCGCTACGAATTAAATATCACTTGCTTGCATGAGCAGTTGATAATAACCATCGACCAGGTCAAGTGCACTGTACATTGTACATTTCTGCCATCGT
TTTCTGAAGAACATCTTTTCTAAGAATGGTTGTTTGTGCCGGTATAGTGGCCGCATTAAGCTTATTATAAGCATGCACAATATGCCACTTACCATTAGGA
TTTTTGACACAAGTTTTTGGTGTGGAATGAGGAGACTTGCTCTCCCGCACCATTACCGCTACGTGCCTAGGAAGAAAGAAATCGTCAATAACGTCACATT
GTTTCTTTGGTAAAGGCGAATGCTTTGTAACACAGGATTTGGTTCCAGGAACCAAATCAATTTCATGACGTACGCCCTTATCGGGAGGTAATCC