Description :
From Genome Similarity Track
Location :
Scaffold_132:43280- 44300
Transcript NameFunction/comments
Phyra_84957Hypothetical protein

Sequence
1020 bases(100 bases per row)
CTACGCAATGCAGCTCAAACACTCGTTTCCGAGGCAGAACTCGGACAGCAGGACTGCATGGTCGGAGCTGGAGTACCCGCCGAACGTGTCAACAAGAATC
GTGCCGTTGCGCAGACAGGTGTTGCTGTCACGACGCGAGAAAATGTAGTCGTACTTGGCGCCCGCTGGGTTGTTCCCGAAAGAAGAACCAATCCACGTGG
GTCCGCCTGCACCAGCAGCCGTTAGCGTGTCGTACATCGGGATCGGTGTGTTCGCTCCATCGATCGGGCCCTGGTTAGCGAGATACAGGACAGCAGAACT
CTCAGGAACAGCGTTCAGGTCTCCGGTCATGAGCACGGTGTCTTCCGGCTGGCAGTGCTGGCTCAATCGTTTTGCGACCAGAAGAGATGACTGGGGTTGG
CCGAGCGTTATGTCGAAGTGTGTGTTGAGCATGCACACAACGTGGTTGGTGGTCTTTTCACGAAAGCGAGCGATGACGGCCGCGCGGAGATACTGAAGGC
CCCACGTGTTTGACGGCAGAACATCAGGCGTATCGCTCTGTCAAATCACAGTGCAAGTTAGCTGTCTGACAAAATCCCGTATGAATAGGAAAATAATATG
TGAATACTCACCAAGGCAAACGTGGAAGTCTCAAGAACTTCCCAGCGATCGGCCCTGTAAAATATGCTGTCGCGCTCGTTCCATTGGCAATCACCCGCAC
ATTCGCCCGTGCTCGCGAACGAAAGCTGGTCCTCGAAAAACTGGATTTGGTCGGGTGCACCTTCTTGGGTTCCGATGAGGTCTGGCTCGTATTTCTCCAC
GAGCTGCTTGGCACGGTCCTTGCGTTGTTCCCAGCAGCCACTTGGACACGGGTCGTTGGCAATCGACGTACGCAGATTGAAACTCATCACCTTCAGTCGA
GAAGCAACGTCGTAACTTGATCCAGATGCAGCACCAACTGCGACGGCGACAGAAAAAACAGTAGCGAGCCGCATAGCAGGCCGGCGTGGGAAGACAAGGA
TGGCGGGGTGGATGCCAGCG