Description :
From Genome Similarity Track
Location :
Scaffold_584:4328- 5951
Sequence
1623 bases(100 bases per row)
GGATCGCCAAAGACCACAGGGCTAATCGAGCAGTCCACTATACACATCGTCCTTTCAAAGACCGAGACCGAAAGATCCATTTCAGCACCGAATACCGCGT
GTATGGTCTCAGCAATTTGCCATCTGACAACATGGTGCAGAAGATGTGGAGCACTCGGAGCAATGCGACAATTTCCTTCTCGGCCGGATGGTATCTGAGA
TCTTGATCATGGAGCACACTCTTCCGTATACTGAACTGGGAGGATGATTCCTTCGTATTCTTGGCTCAACACAGCGCGGACAACCCAGGGATTCGCGTGA
ACGATAATCACGAACGGCTTTTCCCTATTGCGGTGTCTGAGCAGTGGGATAGACACGATCTTATGCTTCAAAATCTCAAACGCTGCCTTGGCTCGGCTGA
GATCTCGGCCAGCTCGAATCTGCTCATCGATCAGCTCGTAGAGGACAGAGGCCACAACCGGGAGGTCTTAAATGAACTTGTTGTAACAGTTCAGACTCCC
CAAAAATGACTGAACCCCTTTTAGCGTCGACGGGAACGGGAGTTCTCGTACCCCTTTTGCGATGTTGGGCTTGTCTGTGATTCATTCAATCCCAGTTTCA
TGAGACAGGTAGAAAATCGTCTTCTTACCAAATTCACTCTTGGGCAAACTCACCGAAATCCCCCAGTATCTCAACCAATACAACAGCCGATCCAAATCGA
TGCACATCTGTTCGCAGGTCTCAGCTCTATACGCAATATCATCAATATACCAACTTCGCCCTAGAACTGGGTTCAGCACAGGTGGAGCCGGGATTTTCCT
TCGGAATACTGTCATTTTCTCTGATGGTTCACGCATGTCACTTTCCGTATCTGAGGGGTCAACCGTGATCCCCAGAAACTCCAAACGTCAGCATTCACTT
GTGCTTCCTTGCTGGACGGGAGACGCACAAAGCCCCAGAGGCAGTTTTCCAGCATCTGCTGATAGATGAGTGGCGCGTTATTCAACCCAAATGATATTCG
CTTCCACTGGAAGTGACCTAACGGGCAAATAAACGCTGATATATATTGGTTCGGACAGTCATTGGCACGGCCCAGAATCCACTTGTCATGTCCAAGCTGA
GAAACCACATCGCATTCTCAAACCCAATCAACAGATCGTCGATCAAAGGCAATGGGTAATGCATGAGCTTGATCAGCTGGTTCACCAACCGGTAGTCAAT
ACAAAGCCGAATGTCGACTcggttcttcttcatcacaATGACGATCGGTGACGCCCAGCCTGAGTCGGAATACTGGACAAGTCCAGTCTCCGTTTTCTCA
GCAACTCATACACCTTGTTGAGGCGGTGGGGCGGAATCTGCCTAGACCTCTGGGCGATTGACTGAGCATCACCCACAGACCACTTCTCGAGCCGGGCTGG
CACTGCATTCCCATCACCGAGAAAGCTTGAGTGATGCCTGTCCAGGATCTCACGGATTTGAACGTCCACTTAGATGTCGAAGCATTCGACCCACCTTCAT
TCGTTGTCGATAGATCCGCACTCGGACTGAGATCTCGCAATTCCGGGAGAGCCGCCAGTTGATCTCGGATATCACTTAGCAACTGACTCCCTTCATGGAA
GAATACACACGCTTCCTCCTCTG