Description :
From Genome Similarity Track
Location :
contig_141:43278- 44486
Transcript NameFunction/comments
g13762.t1hypothetical protein

Sequence
1208 bases(100 bases per row)
GCTAGAGAATACTCCTGTTTAAGTGCCTGTTTGTCCAAGACAGCTTCTTCGTGAAGGAAAACGTCCAGAGGCCACATGCCCCCCGTTGTTGTCACGTTGT
AGAAGTAAGTATCACTGTATGGCACAGGTTATGATGCAAAAGCTCTGCAATCAAGCCGAATCCCGGCTTTATACACTCGGGTGTGCAAAGTCGGGTTCAC
GCGAAAAGCCGCGGCCAAAATGCCTCCTGGACGCGCCGGCACCGACATTCGCGCTCTAATAACTTGCACGTCAGAGCGATCCTGAGGACACGGGCTCCAC
CATTTTAAATGTTTTAGTGAGTGTCGATGCGATGACCGAATTGCAGAAGCATCGAGCGATTATTCGCAGAGTTAGCTTTTGACCGCACTCCGAATAAGGG
GCATTTCCGGTATGTGTTTCTCAGTCATTTAGTGTTAATTGCTTCGTGTTATTAACAGAGAGTCTCCGTAAGAACTGGGCAGACAAAGGGGGTAATTGCA
AAGTGAAAAAATCCGGAAAAGCACCAATTGGTGTCAAACTTGGCACACATACTCACCTTTCCGTCTTCATCAACATGGTCACGTGTGGTGTATCAAGCCT
GTGCCGTTGTCCTTCATATCGACGTCCAGATGAACTCATACTCTTTGCCATATTAAATGACGTTGTGTGCATTTTGAGGGGTCGCAATGTCCTTCTTTGT
GTATCTTTGGTGTGGAAGCGGGTCGCAATGTCCTGCTTTGTGTACCTTTCATGTGGCGCGGTCGTGGCATCACCAGAGACATGGGAGATAACGACGAAGC
TACATGGCGATCAGCTACATGTGCAGCAACGGAAGATGGCTTTAACGCAACCTTGTCTGCACGACAGCATGGTGCAGACAGGTCGGCACTGAGGTGACGA
GTGACACGAAAAATATTAGCCTCGCGACTCCCATCCGCTCACCGAAGATACCTGACCGATCAGGATGAAGAACGCATTCAAATTCTCGTTCGCGAGCGCG
CTGAAAAGAACGCAAATTTCAACTTTGACGAGCTTGCCGTACTTGTTCACGCGACAGCCACGCGCAATTCTAAGGTTACCGCAAAATCATTTCCAAAACG
CAAATGGCTAAATCGTTTCCTTAGAAAGTATCCCGACCTTCGTGAATTAGTTATCCCAACGCGACGCAAAACGCCAGGCACAATACTGATCACACCCTTG
GGGAATCC