Description :
From Genome Similarity Track
Location :
contig_141:43275- 44489
Transcript NameFunction/comments
g14280.t1hypothetical protein

Sequence
1214 bases(100 bases per row)
TCGGGTTGAGCCTTACCAGAGAGATACAATGAGCTAGAGAATACTCCTGTTTAAGTGCCTGTTTGTCCAAGACAGCTTCTTCGTGAAGGAAAACGTCCAG
AGGCCACATGCCCCCCGTTGTTGTCACGTTGTAGAAGTAAGTATCACTGTATGGCACAGGTTATGATGCAAAAGCTCTGCAATCAAGCCGAATCCCGGCT
TTATACACTCGGGTGTGCAAAGTCGGGTTCACGCGAAAAGCCGCGGCCAAAATGCCTCCTGGACGCGCCGGCACCGACATTCGCGCTCTAATAACTTGCA
CGTCAGAGCGATCCTGAGGACACGGGCTCCACCATTTTAAATGTTTTAGTGAGTGTCGATGCGATGACCGAATTGCAGAAGCATCGAGCGATTATTCGCA
GAGTTAGCTTTTGACCGCACTCCGAATAAGGGGCATTTCCGGTATGTGTTTCTCAGTCATTTAGTGTTAATTGCTTCGTGTTATTAACAGAGAGTCTCCG
TAAGAACTGGGCAGACAAAGGGGGTAATTGCAAAGTGAAAAAATCCGGAAAAGCACCAATTTGGTGTCAAACTTGGCACACATACTCACCTTTCCGTCTT
CATCAACATGGTCACGTGTGGTGTATCAAGCCTGTGCCGTTGTCCTTCATATCGACGTCCAGATGAACTCATACTCTTTGCCATATTAAATGACGTTGTG
TGCATTTTGAGGGGTCGCAATGTCCTTCTTTGTGTATCTTTGGTGTGGAAGCGGGTCGCAATGTCCTGCTTTGTGTACCTTTCATGTGGCGCGGTCGTGG
CATCACCAGAGACATGGGAGATAACGACGAAGCTACATGGCGATCAGCTACATGTGCAGCAACGGAAGATGGCTTTAACGCAACCTTGTCTGCACGACAG
CATGGTGCAGACAGGTCGGCACTGAGGTGACGAGTGACACGAAAAATATTAGCCTCGCGACTCCCATCCGCTCACCGAAGATACCTGACCGATCAGGATG
AAGAACGCATTCAAATTCTCGTTCGCGAGCGCGCTGAAAAGAACGCAAATTTCAACTTTGACGAGCTTGCCGTACTTGTTCACGCGACAGCCACGCGCAA
TTCTAAGGTTACCGCAAAATCATTTCCAAAACGCAAATGGCTAAATCGTTTCCTTAGAAAGTATCCCGACCTTCGTGAATTAGTTATCCCAACGCGACGC
AAAACGCCAGGCAC