Description :
From Genome Similarity Track
Location :
Scaffold_28:432444- 436506
Sequence
4062 bases(100 bases per row)
GCAACTTCAACGACTTCAACGGCAATGACAAGACAGTAGCACGCTTGGCGCGCGAGGTCTTAGATGTACTACGCGAGCAGTACGGTCTTGTCACTAATAT
GGAATTTCTTCTTAGTAAAAGAGCGTCTCGCTCATAACTAGGAGCCGGCGTACGAGTTACGTTAGGTAGCTCACAAATGGTAATGTTGCTATCGCTGTAT
AATATAGCTATATATTTATTATATTGTTAAAATTAAAGCGTTAACTTTTGCTTGCCCTTCCATTGCTCAAACGCTAATGTTTCTCCATCGAGTGCGTACG
GCGGCAGTTCGATAAACCCAATAAGCCGCTGCATCTGGTGCCTACACAAAGTTACGTTGGTCTATCAGTGTGAGAAGACATTACCAAGGTGGCTTCATGT
TAAACATCAATCGTGTAGAGGCAGAGTATGACTTTTGGCCTAACCTACCCTCTTCTTGAACACGATGATACTAGTCCATCTACACAAACAATGCATTTTA
GAGGCACCGATAAATGAAATTACGTACCCAAACTAGCGTAGAGGTCGACACTGTCTTTTGTTACGTGCGCCAACGACAGCAACTTTGCACGACACTCACA
CGCTGACGATAGCAAAAGTGACGATTGCAATCCGGTTCGGTTCACCGCCTCGTACATTCAGCTATCCCGGATCTGGAGTTTGGTGAATGTCACTCATCGA
GCTTTCAACAGTCAAGTTCCCCCTCCCCCCGCCATTTAAAAAATGGTCGTTTATTCAGAGCGAGAGGTCACTCATCGAGCTTTCAACAGTCAAATCCCCC
CCCATGCATGGCCGTTTATTCAGGGCGAGTGCCCCAATGTTTTTTTTTTTAATTTGATCGAACCGTACATTATTCGAGTGATTTTCTGGAAAGTGAGAGA
ACCATGAAGGCATAATAACAAAACGTGAAGTCGCACCCTGTCCATCAAAAGGCGCAACACGATTGATGTTTAGCGCTAAGACTATACTCTCACTCAGCTA
ATGTATTTTTCTATCGATATATTCTGATCGGTATACGCAAATTTTCGACAGAGGTTGCTTGAACATTCACCTGAAATACTATGCTCTTCTAGAGCACCTC
CAGCAGAGGATGGGAGTATCACTTTAAGTCGGGGTACAGCTTGATTTGCTATTTGTGAGGATTCTCTTGTATATCGAAAATGGTTGGATCGAATTGGTCA
GATCTGGTCTAGTGGCTTACTCAGACGAGAGATTCCTAAACTCTGAAATAAATTTCGCGACGTTCTTTTGCTAAACGGTAGACCCCCAAAGCTGATCCCA
TTGGTTAAGTGCTGCTGTTAAGGCGCAAGACACGCCTCTTTCGATTGATGCGGTTAAATCGCGATTCGTACATAGGTTGATTAGTAACAGCCGTCTCACT
TATTTCCATGTTTCAAGCTGATAAAAACTTCACATACGCCTCTACTATATTTGACAAATAGCATTTGTTAGATTCGGACAACCGCGCACCATTTCTAGTA
CTTGCACATCCGAGCATCCCGACGTCATTTCGCTGAACGAGGCACACGAAGACTGACTTGTGAGGGACTACATCAGAAGTTACTGAACAAGAGATGTAAC
CAGCAGCATCCGCGCTGCAGCTAACAGTGCCGTGGCGTCTTTTGGGCGGCCCCTCACTATGCATCGTAAGTTTGCCCATGCCATTTTCCAGGGCCCCATC
AACTTCAACATCTGTCGATTTCTCATGGTTACAAAGCCGTTTACTGTTAGGCCATTTCAAACTGATAAAACGGTTTTGATTCGAATCAAATAGCAAACTG
ATCTGTGGAACTATTGTTGGCAATGTAGTTTGCAGCTTCCACTTTGGCGTGCTGGGCGCAGTATGTACGCGATGTGTCGCTCGAGGTCCGCAATCCAACG
TGGAAGTCTACAGACCATACAAGTTGTATCTTTTGTAGACATCCATGTTATGATAGAACTTGTTTTATGAAGCGAATAATTACTCGACTCATGAGCTGGA
ACATGAATGGTAGAGGCGGATAGTAGAAGATTAGATCGATGAGAATGTTTTGCTGGACGAGTCGAGAGTCTCGTTTGTCTAATGTTAGGCTTATGAGAAC
AGCTTATACAGTTCGTTAGTGTATTGTCAAAAGCATGAGCGTGTTTGGGGAGTGCAACATGTGCAATACAAGATCTGCCATGTCCACAAGCGGATCAGCT
TCATCGCGCTGGACCAATAGCCCACCCAGCGCAAGATCACGTCTTGCACAAAGTGCGTTGAAAAACAAAACAAAACAAAACACATTTCAGTCGAAGTCGC
TCACGATTCTGGGGGCGTGCCAAACGCGGCACAATGATGACGAAGTTGCATTGTAGCACCACCACTGCCGGAGTATCCGGGCGTGGGGGATGCCCCTAAA
CTTGATGCAATGCGGGCTTCTGCAGCATTTGCGACGCCATCCGCGATGTCAACTGCCCACTTATGCGCGTGTATCGTTCGACTGCGTCGGACTTCCATCT
CCCAAACAGCTTCACTGCCAGACTATCAAAACCAGCATTAAACAGCGCCGTAGCGCTGCCACTTCGAAGGGAGTGCGAGGCGTAGTCTTGCGGATTATGG
CCAGCTCGACCAGCAGCAGGCTTTATCGCTCTTACCACGTCGGATACTTGCAAATTGTGAGATGCATCCACCTTGCACAGTAACTCGCCCGCATCAATAC
GAAGCACCTCGTGGTGACGAACTAGGTACCATGCTGCTAGTACAGGGCAACATCACCGATGCCCTGATCTCGCCAATTCTCGAGAAGTACCCTTGCCAAA
TTGGTCGGATTTACTCCCTCGAAATTGTAGAATCACCGAAGTCACATCATGAAGGTTTCGGGTCTCGTGGCCTCTAGCATCCACAAATTTGACGTCCGCT
CTCCGAATTGCGTAGTCGTGCATCCTTGAACCTTGAGCCAAATATTCGGATCTTCTCAAAAGAAAGAAGAAGCCCAGCACCGAAGCCTCCCCCAAATGAC
CCGGTGCTGGGCAACTGCGAAATCGAGGAGCTCATGAGGCACTTGAGGATTGCGCTTGTAACGGGAGATTTTGGCTTGCTTGATGGGTCTTTCCGCCGCA
TTCCGGTGATAGCGAGTTGGTGGCCCGGCAAAAGTCCGACGTTGTAACCAAGGGTTCGCCTATGATGCCACGCAATATGGCTGACTTTAGAGAGCACGGT
CGAGGCAGAATTCCCCGATCCCGATTTTCCCCAGCCATATTTCCAGCAGTACGTGGCGAAAAGGGCGAGCTGGTACGAATGTTGCCGGCGGTCTTCTGGC
AGCCATTTTGCGAATTGAAGCCGCTCACACCATCTACACCACTGTGTCCATGTGCTTGCATACTTGATCTTGGACGTCGTGGCCAGTGACACGGACTGAA
GAGATTCGAGAAGTCGATGTAAATTTTCCTGCATTCTTGTGGAACTTGTGTCTGCACCCAACACGAAGAAAAATTAGTCCATCGAGCAATGTAAGGTTCG
GTCCAAGCTCGCGAAGCTGCATCAGCCATCCAATTGGCCAATCCTGGAATATGATCCGCCGATACTCGAAGGTTGAAATACACTTCAGCCAGACCAATCG
CCCGATTTATTTCTTGGCTGAACGCGTTGTTGGAGTGCATCCGATTGCACCAACTCACAGCTGCGGCATTGTCACTCCAACACTTGACATGAATTGTGCG
TCCGTTCGCTTGTGCGCTCCACTTTGAACCCCACGACCACAACGCGATGGCAATGCACAAGTGTTCCCTGACATTGATTGAAAACTCGTCATGGCCGCTA
CCAACTTTGTCGATGAGCAATTTCTCTTCGTCATCAAACTGAATCTGTATATATGACTCGCAGGCGGGATCAAGCACGGCTTGCCCAAGGTTGGACGCGT
CCATATACAGCTCCACGTCCGGTGCCGACAGCTCGCCAAACATCGCAAGCGGGAATTCAGCAAAACAACCATGCATTAAAATGTGCCGAAACCACACGAG
ATCTGTTTTGGCCCCTGCTGTAAGTTTAATTCTGCCGAACCGTGGTGCTGATGTACACAGTG