Description :
From Genome Similarity Track
Location :
Scaffold_22:4324- 10810
Sequence
6486 bases(100 bases per row)
CGAATTGATTATGTCTCGTCTACTTGCGTTCAAAATCTTGCAGTAAGGCTTCACGATTCAAATCAAGTTCTTCTACCCAGGAGGGATCTTCGTATCCATT
CCAACGAACGAGAAAGTCTCGTTGCTGTCGCCCATAACGTGTTTTCTTACCAGTGCGGCTCTCCAAAATCTCTTCGACCTCGTATTCGACCCCTTCCAAT
TCTCGTACCTAACTGTCTTCCAGCAATAGGCATTCGTCGAAATCAACCTGATCTGCCTGGTCAACTGATAGCTCGTTGTCTGGTCGATCAGGAAATTTCC
TGACCTGCTTGAGCTTGAATATGTGTACAATAGGGAGCAGCCGTTTTTTCCGCCCCCCGCGTCTCCCAACGTGCTGCATGGCCTCCTACCATCTCCAGAA
AAGACACGAAACGGTCCGTGCCAAAGATGAGCCAGTTTCCTGGCAAATCCTCCTTTTACTCGGTCGAGATAGAGCCATACTTGGGTTCCCGGTCGAATCT
TGTGGACTACCACCCCTTCGTTCTGCAATTGCACTCGCATCGGACTCGCCTCTCGCAGTGTCTCATTCACCTGCTCTCTTGCTCGCTGGTACTGGATCTG
AATGCGATACCTCCACCTTCTGGGTTCAGACTCCTGACGTTGGACGTTCACTGTCGGTAAAGTGGCTTCAAGGGTTGACCTGGCATCCCAACCGTGGACC
AAATATAAAAGGCGTTTCTTTTCGTACCCGGTCCTGAGCGGTATTGATCTTAAGCGTTAACGGCTTTGCGTACTCGTCCCAGTCTAGATGCCTTACGTCC
GCAACATACAACTTGATAGATCTGGTTAGAGTCTGGATCATCCTCTCCGCCGTACCATTAGATTGGGGTCGGTAGGCCATTGTCGCTTGCTGACGTTGAC
CCGCCATACGGATAAACGTTCGGAACAAATCTGACTTAAATCCCGTTTCTTGATCATGACAGATCGCCTTGGTAGCCCCAAAACGACGGAAAATACACTC
TTCATATCCCCCATCGACCGTCTGAGCTGTCCACGACGCGCTAGCCTTGGCCATTAATATCCGTTGAATAGATCAACCCATATCAGAAGTTCTGCAAATC
CTTTATACGACTTAGGGAGAGATGAGATATGGTCCATCGCTATAACTTGAAAAGGATAAGTCGCTTCGACACTCCCAGGGCTCCTCCCTTGTAGATAGGT
CCACCTTTTCCAGTCGCGCAATCCATGCAAGAACCCCCATATCTCTGCACGCTCCGAAAAATACATTTCCAGTGACAGAACCGTCGTATGCGTTGGTAGG
TACACCCAATTCCTTGATGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGCAAGTTAGTCTGGAGACTTTCCGGTACCACCAGTCTGACCGTCATGTC
GCGGCCTTCTCCCTCGACTATAGAGTTGGACAATACACCAACAATCCTTACTCGCTGATATCGTAATCTTCGTACATTTTGCTACACTTTTTAGCGGATT
CTACCGACAGGTCTCTTCAGTCCGCCTTCAAATATGCATTCGAATCTCCTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTGCATGGTCCCTCC
AGATATCTCAATAGGAGATCGCGACTGAATTACCACAAATATTTTAGTATAGAGACTCTGGTCTTTAGGAGCTAGCAGCTCATCAGACGATTGATCACGT
CCAATCCTGGTCTTTCTTCACTCGGCATAGACTTGATCTCCCCTTTCTGGTACAAGGCTGTACTAGCCAACTGATTTGCGCTTCCTGGTTCCAGTCTCGT
TTCACATGCTGGATCCCGTGAGAAGTCCACGATTGGAGTTCATTTGAAGCCCGGTCTCGCAGTGATGATAGACCCTAGGCCTTACACTTAATCTCCCGTC
GCATATGCCGTACCACTAATTTGGAGTCTCCACAGATAATCAACCGCCGCCGCTCCAAAGTTTTCAATAAGCTAAATCCAAGCAACATACTATCATATTC
TGCCTTATTTACCGTAGATGTATCGACATATTTGGAGGCGGCTTCGACTATGGTCCAAGCTGAGAGTCTCCATACGATAGCGCTAAAAGCCCCGCCTCCT
TGCTTAACACGGGCCAACCCATCAAAACGCATTACATATAGTTCTTCTTCCGGTTCTACGGTTGGGGTGGGTAGGTTGATCGTCTGCCATGCCTGATTCT
TAGGGGCAATGGCCGACAATATTGAGTCTGCACTCTATCGAAGGGTAATACTAGCTTTCAATGCCCCCAACACCTGGTCTTCACCTTTTTACACTTCACG
ATCTCCAAGGTCCACTGAGCCTAGAGAGCGTCCCAGTTTCCCAAACGCCCCTGCAAGCCGGCAGATTTCACTAACTACGTCAATGTCGAGTATCACGTCA
AGACTTTTAGGGGCTGAGTGACCAACATGGTGAAGCAAGTTTCCAGTATACGTAATAAGACTAACACTTCTTCCTCTACACTACTGTAATATAATTCGTT
AGCCTTGAGAGTTATGCTTGTAAAAGCCGGCATAAGCAGTTCTTCATAATACTTTACCAGTGACGCCGAAATGGCCCATTCACTTGCATAGACAATAATC
ATGGCTTCTCTGGTCGGGTTGAAGTTTCTCAGAATTGGCGCCGTGGCAATTTTATTCTTAAGCATGGCGAAGGCCACTTGGACACGGTCCACCTTTCTTC
TTGTTCATCCTGGAAGTGGCATTGTTATCTCGTTTTAACTGGTTTCGTCGGGCATGAAAGTCCACCTAGCTCAGTTCTTAGAGAATAGATGCATATACTG
CATAGTCTTCAATAAACCTGCTATAGTAGTTCGATCTTCCTAGATAGGATTGCATAGCTTCAGTGTCATTGGTAAAGGTAGGTCGACTAGAGATTGAAGA
TCTTTCGGGTGAGCCTCTAGTCCTCCACTAGATACTCGATGCCCAAGGTAGTCGATCTTCCGACATCCCCACAAACCCTTGACTGCGCAGATCGACAAAT
TCCAGTAGTCGCACACATCAAGCAGTCGTTCCACTTTTGTGCACAACGCATCCTATGATTCGACAGGGATGTAATCTATATATGACCGCCGACTCAGGAT
CGAGGAACTAGACTGCTCATCTGGCTCTCTCACCTTTAACAAATCCTCTGACACATCTGCCTCTGCTTCTGGAGGTATTCGCAAAAAACCATATAGAGCG
TTATTCAGGAGTTGCTAATATATTTGGTGCGCGTTCTTAAGCCCAAACGGCATCCGCATCCATTCAATCAGACCCAGTGGAGGCAATGAACGCCAAAATT
TTTGGCTCTCTCTCTCATTCATACCTAGAAACCACTTGCCATGTCAAGCGAGAAGTACGACAATGCTCAATCCAAGTTTTCGAATAATTCATTAATCAAA
GACATGGGATAGACCTAAGTTGAGTCAGGTCATTTACCAACCTATAGTCGATGCACATCCTGATGTCCACCTCATTTTTCTTCACAATAATAACAAATGG
GTTGGCCCAGGGTGAGTTAGACGTCTGTACAATTATCACAGATAACATCCCCTTGATCAGGTCGTCCAACTTCTTCTTGAATTGAAGACCACTTTTTGTG
CGCGTTGCACGTTGCGAATCGGATTTGCATTTCCCACATCAATATCATATATATCCCCTCGGCCGGCTGGCGGTAAGGCATCCACTTTTCCTATCAGCAG
ATGTCGTCTTTTCCATATAATCTGTCGTAGCGAGTCGACATCTTCTGGATTGATCCCATCCGGATCAGGAATCTGTATATCTTTTAACCCAATAGTCTCA
GAGCAGGAGCCCATCTCCGGTATTATTACCCATCATCGTTTATGTCTTCAGCCCACAAGTCTCTACTTTAGAACGTATAAACTTGTTCATCGTCCCGTAG
CGATTCATTGGCCTAGGCTTTTTCCTCATTGACTGCGATCTCTACCAGTGGATCGCCTTTGGGACCACTTCGTTCTTGAGGGATTTCTTCTCGTAGAAGT
ACCTCTTCTTCGCGTGACTGTTCTTTTCTCTCTGGTAGCGGCTGGTGTGACACCCCACAATTCATCATTTGGACTTAGGTCTTTGAACGTTGCAAAATAT
GCGACGGGATATTGTACTGCGGTGTATCCACCAGTGGTGTTTCTTCTCCTTCCTCGAGGTCAACTTGGGGGTCGAGATGGTCAGTGGTTGCTTCATACGC
TAGATTCATCCACTCAGCGTACCTTCAAAAACTCACTGAGACGAAATCTTGTGCTCTTGGTACTTGATTCTACGTCAGCCACATACCTATCTTGGTGCCA
TCATGTGATATCAACGTGTGGGGGCTGACGTTGGTCACCTTCATCAATTGTCGGCGTTCTATCCCCCGGGTCATTGTTGTAACCCGTCCCTCTCCTCTTG
TGGCCCACATCTTCCATTGTTCTGAGGTCAACCTCTTTAGAGGTATTTCCACACACCCACCAGCAAGTATACACATATTGTCCCAACCTCACGTCTGAGA
CTCGGTTATTGTAGACGGTCCTCAGTCCAGAGAGTTGTATCCGGACTTCGTTAGAGAGGCAGAGTGTTTTATCCACCAGGTCTAGCTGGATAACATCCGG
GACCATGAAGTCCATTCCCAAAATCGCATCCTGAACCACCATAGGGCCTACCTACACCTTGAAAACGTACACTAAATTTCCATTTAGGGTGACCTTGATG
CGAGTGCGCCCTTCCCGTGAAAGCACACCATTCCCCGATGCCAATGCACTCTTTTTGTTCGCTTTTGACAATTTGACAGCCTATCTTACAAGCAAAGGCG
ACATCCAAAATGGATATCTCGGCGCCTGTATCGAACAACAAATTATCGCGATCGTTGTTGATCTCCCCCGATGCTTTGGCTTGTTTAATCCACTTAGTAG
GGGCATGATATTTCCAGTATCCTCTGGATTCTCCAGGCAGTAGTTCTAACTCCATCATTGCTTTTTCTCGGGCGAAATCATTAGGTTCACTGAGAGAGAC
AACATGGTCCATAGGGTATTCTACAATCTCCGATGTACTATCGATCTTCTCAGTGGAAACCCCCCTCTCCTCTATGGGCTGCTTTTCCACGTATGCAACG
ATACAAAGACTAGAACGCTCGACTCATACCAGATTCAACCTGGCGAGCGTTCTAATTTATCATCTTTTTCAACTTTCTCCGGCAACATTCCGGCGTGCTT
GGTGGGGTTGTACCATTGACGAATCAAATTGTAGAAGTCCTCTAGCTGGCATTTCCCCGCTTCATGGATGTCTCCGCATACACGACACACGAACGAGCAG
CGATCTGATGGGTTACCCTTCTTCCTGCAGTGGTCACACGTTATTCTCTTCCAGCACCTCAATTCTCCATGTTTTCTGGATCCGCAGTGTGTATATCACA
CGTTCATCTCGGCCGACGTATTGCGAGGTACCGGGTCTTCTGCTTGTTTCCGATGTTGGTCGGCCTCTCTGGTGGGTCGCTATCTCATGGTTCTTGAACT
AGGGTCCTTTTCCGCTTCCGCTAGGTAGATTCGTCTCAGGTCTCCCTTGTTATCCGAATCATCCAGGCTGGATACCTCCGAGCTCGACTCTTCTAGGGCC
GCTCGAACTGCATGCACGGAACGGAGGTTTGCATCTCTGGGTCGATCCGGAGGAGCTGGCACCTTCTGCCGGAACTTGATGGAAAAAACCAGCGTCTTTC
CACGCCATGCCTTCGTCTTCTGGCTCGCCTTCAATAATTTGTCCAGGTCTTCCACGTCTGCCAGACGTAGCATCGTCAACTGGTCTGCCAACTCTGGGTC
GTCCACGGCATCGATGTAATGCTCGACATGTTCCTAATGGATCTTGGGCAATCCATCTTTGATCTTCAGCTTCTCCCTGAAAAAATGACGTTTAGGTGGT
ACAGGTAGTCCAACGGGTATTCGCCTGACCTTTTCTTCGCGTGGTAGTACTGGCGGGCAACTGGTACCCCCAGATGACAAAACTGCAGCTGGAATTCTTG
CAGCAGGTCTTTTCAATTTCCTCGAGCGAAGCGGACCAATTGGCGATACCATTTCTGAGCCGGCCCGATCAGCAGTCCTTTGAAGACAAGACACTTTTTG
CTGTCCGGTAATTGGTCCCTTGCAAAGACCGTCTTCACCGTGGTCACCCAACTGCGTGCTCGGTACTCTTCCAGGTCTAGACCATTGATCTCTTTGAGGT
CCGAAGTTGCAGAAAGCTTGATGCGAGGAACCATGTTGAGTACCTTTCCCATCGTGACATTGGCCATCCTCGCCGAGGTCTCCTTCAGACCTAGGTCATC
CGGGTCGTGTTCGCACAAGCCGACCGATTCCATGTCGACGTCCGACATTGTGGGTTGTCGTGGGGATTGGACCTCTCCAGTAGTCTCTGGTCGCAATTCA
TTTCTCTCTGGTCTCTTATCGGTTAGGGCATGTTGATGGCGCTTGGAGTTCTTGGAGAAACCATGCCATCGCCGCGTCAAAGTATG