Description :
From Genome Similarity Track
Location :
contig_1:432370- 435300
Transcript NameFunction/comments
g159.t1hypothetical protein
g160.t1XP_009530641.1 hypothetical protein PHYSODRAFT_346958 [Phytophthora sojae

Sequence
2930 bases(100 bases per row)
GAAGACCACGCGGACGCCTCGCCGGTACCACAGAAGAAGACTCCTGAGGCTGCCACCGCGTCGCCGGCCGTGGAGAAGCGCAAAAAGAAGCACTCGACCG
ACAAGCACGAGAAGCACAAGTCCAAGAAAGCCAAACACAAGAAATAAAGACCTTGCGACGGAAACAATAGCGCAGCCCTCGATAGACCCCCACGAAGAAT
TCATCACCCACCTATTTGTCATTTTGTTCTTCTGACGCGGTTCGGCCGAGCCTCGACCTCGTCGAAAAGATAGTACCTGCAAACGAAGAGGTGGTCGTCT
AAAAGAGCAGAAGCGGTGCATCTGCTGGCGGCGCCTCCTGACGTTTGGAGCTCTTGTCTTTCCTTTTCTTCTTGCCCTTCTCGGCCTCGCCGCCGTTTTT
GCTCGAGCTCTTCTTGTGGCTTTTCTTCGCAGAGGAGCTCCGGTGATGGTGGCGGCTCTCCTGCACTTCAGCCTCTTCCTGGTCATCATCGCTGAAGCCG
CCGATCAGCAGATCCTCCTGCTTTCGCGAGGATTTTTTGGACTTGGAACTCTTTGATGACGTCTCCTTTTTCTTCCGTTTCTTCTTGTCGTCATCCTCGC
CGCGAGGAGCCTTCTTGTGCTTCGAGATCTTCTTTTTCGACTTCTTCTCCCCTTCCGTAGGCTTAGCAGACGGCGTCTGGCGATGGAACCACTGATCGGT
CGGAACCTTCTCGTCTCAGCCAGAGGAATGCTCAAGTCCACCGCAGACAAATCGGTCTCCTACCATTAAGAGATTAAGGGTAAGTGCGCCAGACGAAGAA
ATAAAGGAATAATCAACAAATGACAACGTACATCTCCACCCACTGAACCACGCTTCTTTCGAGAGCGCCGACGATCTTCGTCGCTTGAACGTGCACCCTC
GGGCATCAACTCATCCTCCAGAATGTCACGTGACTTTGATTTCTGCGAAACACAAAAAACTGTTTGTCAGCATCGACCATTTCTCGACTTTGACAATCAA
TAACTGCATCGCACCTTCGACGCTTTCTTCTTCTTCCCGTTCGTGCTGGAGCCCAAAGCACCCATCATATCCGCAAAACCCTGCAATCAGCCCAAGACAA
GTCATTAGAGACTGGTTCAGCAGTAACATATCACAATTTGCGCATACCGCGTTGACTCCCGCATCCGCTGAAGCTTTTGATCCAGCAGACAGATAAAAGG
GGTCCTTGCGAAGTCGTTCCTGCTCGCGCACATATTCGCGCTCCTTCCTTTCTTTCTCATCGGCAGAGTTTTCAGACTCTGATTCCGATTCTGAAGATGA
AGACCCGTGGTGCTGACGCTGACGGTGGTGCTTGCTCCCAGGCTTCCTTTCGGGCGAGCCATCTCCAATGCCATTGTAGCCCCCACCAACGCCAGCGTGA
CCCTGGCTAACGAAGGAGACCTCAAGGTCATCTTCACTCGAAAACGCTGACACGTCACCACCTGATTCAAGAAACTTGGCTTCTGAATTACTCAGTGGCT
CATCGAGATCCAGATCACCCGGCAGTGGAACCTTGCGCTGTGCCTTGACGCCGACCGGTGCCAATCGCTCTACGAAGAACGAGTTCAGCACATCAAGGCG
CTTGGCGGGGTCCAGGGATGCGCTGCCGTCGAACGCGCGCTCAGTACGTTCTTGTGCGGTAAGAGCGCCAAGACCCATACCCAGTGCGAGCAAAAGCTGC
TGCAAGGATACAGCACGCTCTTGCACCTCAATGTACTCGCTCTGAACAAATGCAGGCAGTCGTTCCATGATAACCGTAGCAATACGCTCCACCGTGGGAT
CATCTGCACGTTCAGCCATAGCAGTAAGGACCTTCAGAAGTGCCTGGATGAAGACAGTCTGCACATGACCAGGAAGAGTCGTCGTTCGGAGCTGCAGCAT
CTCGTCAGCGAGATCTTCTAATCGCTGAAGCTTGTCCTCCTCCGTTTCTCGATCTTCATCGTCTTCTTCATCCTCATCGTCCACGTCATCCAAAAACTCC
ATCACGTACTCACCGGTGATCCAGGCCGCCGCATAGTACACCTCCTGGAGAGTACCAGCTCCAGGACCACTGAGCGCCTCCTTCTCCATCAGCAGCTCAA
TCATGTTGTCCACCATAACACTACGCACGCTCTTCACACGAACCGCAATGTCCACAAGCTGCCGCGCCACCTCCACGCCATGCGAGCGCTTGGCAGGTTC
TTCGTCAGTCACCTTCATCTTATGGTTACTGCTACTGCTAGCGTCAAGCATACTGCCCGATGACGGTGCTAATGACGACAGCGATGCGTCAACTGTAGCT
GCGGTGTTGCCAGGGACACGAGCAAGCTGCACGAGCACGTGGATATACCAGTCGAAGTCGTGAATGTTGGCGTATTTGTTGACCGAACAAACGTGCAAAA
TGTGCGTGATGAGTTCATGACGGTAAGCACCATCAGCGCTCAGCGTCTGTCGCATGAGCTCACGGATAATAGGCGCTGCGTTGTCCGGATTTACCATGCC
CGATAGCAGCTCCAACGCCCGCATCCGAATGGTAATATCGTCCACAGTCAGACACTCGACAATCAGCTCCTGGTGTTCCGTGACCACGTACGGGTGCGAC
TTCATCAAGTTGCCAAGTCCAACAAGACCCAAGTAGCGCAGGTTCTGGTCCGGGTCCTCAATGTAGCGGCGCAAGTGGTCATTGCAAAGTCTGACGACCG
CCGCCACGTTGCGCGGCTGCGAGCCGTCGCTCTTCTTGGTGTACAGCAACGCCGTGGTGACGGTACTGATGCACTCGTACAGTAGCGACTTGGCCGGCGT
ATTCTGGATGACCGTCGCGAGTGGATCCAGCAGCTTGCGCGCGAGACGAGGCTCTTCCGGCACCAAGCTGGCCAGCAACTTGACGACCTTAATGAGCATC
CAGTTGTTGGAGGACGTGGTGAGCAGTCGG