Description :
From Genome Similarity Track
Location :
contig_1:432365- 435295
Transcript NameFunction/comments
g135.t1hypothetical protein
g136.t1XP_009530641.1 hypothetical protein PHYSODRAFT_346958 [Phytophthora sojae

Sequence
2930 bases(100 bases per row)
GCTCGTGAACGCGCTGCCGCTCGCCTCGGACCGTGCTCGCTTTGTGCTGGGCAAGCCGTTCTCACGCTGCTTCTCGCTCGTGGAAGACCACGCGGACGCC
TCGCCGGTACCACAGAAGAAGACTCCTGAGGCTGCCACCGCGTCGCCGGCCGTGGAGAAGCGCAAAAAGAAGCACTCGACCGACAAGCACGAGAAGCACA
AGTCCAAGAAAGCCAAACACAAGAAATAAAGACCTTGCGACGGAAACAATAGCGCAGCCCTCGATAGACCCCCACGAAGAATTCATCACCCACCTATTTG
TCATTTTGTTCTTCTGACGCGGTTCGGCCGAGCCTCGACCTCGTCGAAAAGATAGTACCTGCAAACGAAGAGGTGGTCGTCTAAAAGAGCAGAAGCGGTG
CATCTGCTGGCGGCGCCTCCTGACGTTTGGAGCTCTTGTCTTTCCTTTTCTTCTTGCCCTTCTCGGCCTCGCCGCCGTTTTTGCTCGAGCTCTTCTTGTG
GCTTTTCTTCGCAGAGGAGCTCCGGTGATGGTGGCGGCTCTCCTGCACTTCAGCCTCTTCCTGGTCATCATCGCTGAAGCCGCCGATCAGCAGATCCTCC
TGCTTTCGCGAGGATTTTTTGGACTTGGAACTCTTTGATGACGTCTCCTTTTTCTTCCGTTTCTTCTTGTCGTCATCCTCGCCGCGAGGAGCCTTCTTGT
GCTTCGAGATCTTCTTTTTCGACTTCTTCTCCCCTTCCGTAGGCTTAGCAGACGGCGTCTGGCGATGGAACCACTGATCGGTCGGAACCTTCTCGTCTCA
GCCAGAGGAATGCTCAAGTCCACCGCAGACAAATCGGTCTCCTACCATTAAGAGATTAAGGGTAAGTGCGCCAGACGAAGAAATAAAGGAATAATCAACA
AATGACAACGTACATCTCCACCCACTGAACCACGCTTCTTTCGAGAGCGCCGACGATCTTCGTCGCTTGAACGTGCACCCTCGGGCATCAACTCATCCTC
CAGAATGTCACGTGACTTTGATTTCTGCGAAACACAAAAAACTGTTTGTCAGCATCGACCATTTCTCGACTTTGACAATCAATAACTGCATCGCACCTTC
GACGCTTTCTTCTTCTTCCCGTTCGTGCTGGAGCCCAAAGCACCCATCATATCCGCAAAACCCTGCAATCAGCCCAAGACAAGTCATTAGAGACTGGTTC
AGCAGTAACATATCACAATTTGCGCATACCGCGTTGACTCCCGCATCCGCTGAAGCTTTTGATCCAGCAGACAGATAAAAGGGGTCCTTGCGAAGTCGTT
CCTGCTCGCGCACGTATTCGCGCTCCTTCCTTTCTTTCTCATCGGCAGAGTTTTCAGACTCTGATTCCGATTCTGAAGATGAAGACCCGTGGTGCTGACG
CTGACGGTGGTGCTTGCTCCCAGGCTTCCTTTCGGGCGAGCCATCTCCAATGCCATTGTAGCCCCCACCAACGCCAGCGTGACCCTGGCTAACGAAGGAG
ACCTCAAGGTCATCTTCACTCGAAAACGCTGACACGTCACCACCTGATTCAAGAAACTTGGCTTCTGAATTACTCAGTGGCTCATCGAGATCCAGATCAC
CCGGCAGTGGAACCTTGCGCTGTGCCTTGACGCCGACCGGTGCCAATCGCTCTACGAAGAACGAGTTCAGCACATCAAGGCGCTTGGCGGGGTCCAGGGA
TGCGCTGCCGTCGAACGCGCGCTCAGTACGTTCTTGTGCGGTAAGAGCGCCAAGACCCATACCCAGTGCGAGCAAAAGCTGCTGCAAGGATACAGCACGC
TCTTGCACCTCAATGTACTCGCTCTGAACAAATGCAGGCAGTCGTTCCATGATAACCGTAGCAATACGCTCCACCGTGGGATCATCTGCACGTTCAGCCA
TAGCAGTAAGGACCTTCAGAAGTGCCTGGATGAAGACAGTCTGCACATGACCAGGAAGAGTCGTCGTTCGGAGCTGCAGCATCTCGTCAGCGAGATCTTC
TAATCGCTGAAGCTTGTCCTCCTCCGTTTCTCGATCTTCATCGTCTTCTTCATCCTCATCGTCCACGTCATCCAAAAACTCCATCACGTACTCACCGGTG
ATCCAGGCCGCCGCATAGTACACCTCCTGGAGAGTACCAGCTCCAGGACCACTGAGCGCCTCCTTCTCCATCAGCAGCTCAATCATGTTGTCCACCATAA
CACTACGCACGCTCTTCACACGAACCGCAATGTCCACAAGCTGCCGCGCCACCTCCACGCCATGCGAGCGCTTGGCAGGTTCTTCGTCAGTCACCTTCAT
CTTATGGTTACTGCTACTGCTAGCGTCAAGTATACTGCCCGATGACGGTGCTAATGACGACAGCGATGCGTCAACTGTAGCTGCGGTGTTGCCAGGGACA
CGAGCAAGCTGCACGAGCACGTGGATATACCAGTCGAAGTCGTGAATGTTGGCGTATTTGTTGACCGAACAAACGTGCAAAATGTGCGTGATGAGTTCAT
GACGGTAAGCACCATCAGCGCTCAGCGTCTGTCGCATGAGCTCACGGATAATAGGCGCTGCGTTGTCCGGATTTACCATGCCCGATAGCAGCTCCAACGC
CCGCATCCGAATGGTAATATCGTCCACAGTCAGACACTCGACAATCAGCTCCTGGTGTTCCGTGACCACGTACGGGTGCGACTTCATCAAGTTGCCAAGT
CCAACAAGACCCAAGTAGCGCAGGTTCTGGTCCGGGTCCTCAATGTAGCGGCGCAAGTGGTCATTGCAAAGTCTGACGACCGCCGCCACGTTGCGCGGCT
GCGAGCCGTCGCTCTTCTTGGTGTACAGCAACGCCGTGGTGACGGTACTGATGCACTCGTACAGTAGCGACTTGGCCGGCGTATTCTGGATGACCGTCGC
GAGTGGATCCAGCAGCTTGCGCGCGAGACG