Description :
From Genome Similarity Track
Location :
Scaffold_1113:4323- 8463
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1113-snap-gene-0.6Lipase domain protein
Pytar_ATCC12531maker-par_contig_1113-snap-gene-0.7Conserved gene of unknown function

Sequence
4140 bases(100 bases per row)
CTTGAGAAAGCCCAGCACCACAAACAGCTCGTTCTGCGTGTCCACGGTCGCCTTGTCACCGGCCGCGTACTTGGGCATGCGAATGAGCGTCATGCTCGTG
TTCACGCCGAAAAACACCATGCCAAAGATGATTTTCGGGATCAGCTCGATGAAGTTGCCATGGTAGTCCATGAGCTTGAGCCAGAATACATAGAAGAAGG
CCTCGGCGAACGACTCACACGAGTCCGACACGAACTGCGTGCGCGGACTGACTGTGCGGTACCACTCGATGGTCGCGTAGATGGGATTTTGCCACAGAAT
CAACACGACGCCGAGCGCGAGCACCCACTTCTGGACGGGGAGGATCTCTCGCCACGACTCGTGGTAGTTAATGACGGCAATGAACCAGCACGGTACCGAC
AGCAACGTCGCGACCAATAGACCTGTTCGCAGGATCAGCTCACTCACGTGGATGGCCGGTTTGCTGGCATGAGGGATCAACAAACCTCCGTTAGACTGGG
GCAACTCGCTTTCCGTTCGTGATCGATTCGTTCTCCACGTACGTGTAGGCAAAGTCGTAGGTGATGTGCTTGCCGATGGCGTTTGGGTACATTCCTTTAA
AGAATACGATCGCCAAGTACGAGCCATAGCCACTGCCGCCCTATTGTTCATATTAGCCATCCGTCAGCCAGAGTCAATATCGGTATCCCACGAGGAGCTA
CACGTACAAGATCCTGGCGGACTTCAAACAGCTTGGTCGGCTTGCACCCGTCGCGCGACGGGCAGTCGACCCAGACGCTCTGGTTGAATTCGGTCGCGAT
CCATTCTTTCGTGAACGGCGTCGTCTCGAAGTTTACGCCGTAGAGAAAGAGATCGTACCGAAGCACGAAACTCTCCTCCAGCACATCCAACGATATGACG
GGCGGCGCCGTCACGCGGATGGCGCGAGTCGAGCGATTGGGTTGGTGGTGACGGCGCGGCGACATCATCGCTTGATGCTTCCACAGTGCCACGTCGACAC
TATTGACAACAGTGGGACGTCGCGCCGACGGATCCTTGAGATCACTTACGACGAGACGGAGATCGATCGTGCCGGCGTACACCGAGACGTTGCTCACAAA
CGCCGACCACCGCGCGATGCCCGTGGACGGATCCACGTGGATACACGGCGTGTCGTCACGCCCTTTCAATCGATCCGGTGTCCTGCACTCGTCGCCCGGG
AGCGTAATCACCTGCAGTCGCAACATCTCACCATGAGCTCCCCACATTCTGCCAAACAGATTCCCCACAAAAAGAAGGTCTCACCGTCTCCAAAAAGCCT
TGGCTCTGCACGTACGGCAGCACGAACGCAAACACAAACGACAGGTACGTGATCCAGAGCACCGTCATGGCCGCACGCGACGACAGCGTCTCCAATCGGA
TCTGCGGCTCGGCGGCCGCGCGGTGGCTGTGGTCGTGGACATGGACGCCGTGCGGCAAGAGGAACCCATCGTGGGTGCGCGCGTAGCCGCTCGTTCCATG
CTGCGCGCCGAGCAGCGCCGTGGACGGCGAGAGCCGCGCGCGCATCTCGTACGTGTCTCTGTACATCTCCGACGACGCGTACCCTTTCGAGTTGAAGAGC
AGCGGGCGGTAGACGCGGTTCTCATCGTCGCCGTCGAGTTCGGACCCGTCGACGTAGATGCTGTGGCGCCGCGGCGTGCTGCGCGAGCCCACGGACGAGA
TGGTCGAGGACAGCGGCGTGGGGCTGCCGCCGCTGTTCCCGCTAAAACCGGTTCCGCCCACGCGCCGCGCGCGCTGCTGGCGAGGCGACGCCGTCGCCGC
ATCGTGCTTCCGCATTTTCTCGGTCGGAAGAGAATCTTACAAAGGGACGCAGAATGGAACAGGAGGAAAGTGTGGATACTTCAAAGACGATTGCGGTGGT
GGAAACGAATTTACGAGCTGCTATTAACGTTTAGGAGGGTGTTTTTAACGTTTAAGAGAGACCAAAAGCGGTTGAGAACACCGTAAACACTGTTTTGGCC
AAGATTCGTGAACATCTAGAAGCCCCATGGATCAGTATTTTGGCTGGACGGCATCGATGGCGAGCCAAAGTCGCCAAAAGCGCCAAATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTGGTCCGTGGCAAAGCCACTTCCACCACTAGTGTCCCATTTCGTAGCCGCTGGATC
CAGAGCCGACGTCAGATCGGTGGCGGTCGGGAATGGCGCATCGCCAGCGAACGGATCTACGACGGTCGTGGCTGTATAGCTGACTGTGCGGCTCGCCACA
CGGCTATTCGTGCGGCTGCCAGCGGAGGCACCATCGAGCAAGGCTTTCTCCACGGACGCTGTCACTACGCGGGCCTGCGAGCCGCAGAGAATCGCGAGCA
CGTCGCGGGGCTGCCGGGCCATCTCGTCCACGACGGGTTTCGACGACCGCACTTCGCAACAGCCAGTCCAGAGGGTGCCACTCGCCGTCGTCGCCGTGAG
CGTGAGCGAGAAGGCAATCAGGTCGTCCCACCTTGTCTTTGTGAGAAGGCAGATCTAATCCAAGAGCACGGTCAGTACAATAAAAACGGCCATGGCCATG
ATCAGTCAAGATACCTGAGTGTGCGTGGGCAAGTCGACGAAAAGCCCGGCGACAATGGCAACACGGTCACTTGCCTGATTCACTAGGACTTGCCCGCGCG
AGAGTGGTCGCGTCGGGTCGTGGGTGCTTTCGATGTCAAAGCTTGTACTGTCTTCAGCGGCCCGCCAGACCTGCTGGAAGACCGCTGGGCGGCTCACCTG
TACGTCTGCTGGCCGACGGAAGAGCGCGTCAAAGTGGACTGTGAACGCACGCGATGGCGCAACGCGGATCGATACCGACTCGTCTCCATCTGTCACATAG
TAAACCACTTGACAGTAGAACGTGGCCTCCGCGAAACGCTGTACGAGAAACCGCTTTTCGGCCTTGAGCGTGGCGTACGGAGGTAGGCTGCTGCTGGTAC
TGCCGCCTCCTTGCTGGACGCGAATCTTGAGGTCGTTCGACGGGTCAATGCACCGCACGGGGCCGTGTGGACGGATATGGATCTCAAAGTCGCTCAGCGG
GAGAGTGCTCGTGTTGCAGCACGACACGCAGAGCGCGATCGCGTCCTCGTGGCCGGCAACCGTTTGCTGATACGTCACGTGCAGCGTCAGCGGGTCGGCG
CTCCCCGTGACCAGCAGCGGAGGCCGGGTTCCTTCGGCGGAAGCGAGGGCTGACAAGGAGGGCACCGACTGAGGCTGAAGCTGAGGCTGATGGCGGTGAG
GCTGGAACACGCGCTCGGGATGAAAGACCTCAAACACGTAGACGTTTGCCAAGGCACTCGCGTGGTCATCGAGCGGTTCCTCCAAGCTGGAACAACATCA
CAACACGTTAGCCATCTCTACTGCCAAGCATAGACTAGCATACACTACGGTGCAGTATGAGGAAGCCGTACAGGTGGGTCTGCAATGTGGACGACGGCAC
GTGGATCGCGAAGTACGATCGGATACTCGCCTGCAACTCTTGCAGCACGTGGCGATCCCCAACACCGCATAGTGCCTTGAGAATTTCCGAGACAGCCATG
ACCACGGCCGCGCTGTGCTCCTCGCGTGGGGTCGATCCGTGATGGGTGTCGCCGCCGTGGATACTGCCGCCACCCAGCTTCCCATCGTCAAAGACAGCCG
ACGACGACGATGCCGCCAGTGCTTCGACAGAGAACTCTCGCTGAGTGTCGCTACTGGAAAAGGACCGGGAACTTTCGTGCGAGACTCGCTCCAACAGTTT
AGCGGTGGGCAGAAGTTGGTGGCGCTTCTGGAGCAGGATGCCGATCCAGATGAGCTGCAGCCGCACGGCGCAGGACGAGATCTGTGTCCACGCGCGCTGG
ATATCGTGCTGGTAGAAGTGGAGCGACTCTTTCAGCGTGAGCGACGGCGTGCGGAGCATGGTCTGGAAGTGGTCACTGAGCAGGGCCACGTAACACAGGA
CGTCCTGGGTCTCGTCGTCGTGCTGCGGGTGCGCAAACACTGACGCGTTAGTCTTGTAGACAAGCACTTGGATAAAGGCCTTGAGCACGATGAGCTGCGC
GACTTGCAGCTCCATGCGCGCGTGCGGGTCGCGCTCTCGC