Description :
From Genome Similarity Track
Location :
Scaffold_10:432211- 433800
Transcript NameFunction/comments
Physo_130164hypothetical protein

Sequence
1589 bases(100 bases per row)
GTGGGTTGATTCTCAGGGTAATTTGATCCTCTGGGGCACTCTGAGCCACAGCAAGATGAGGTGTACTCTGGGATACATTCTCCAGAGACACTTTCCGCCA
GACTTTAGGTACTCATCGTAAGGGAAGCCCACGGCTGGACTGAGTGTTCTCTGAAATTCTGGGCGTGCACTCCCAGGATTCACACTTCCAGCCAGTTGGG
CCCATCTGCGGTCAGACGCTGGATTCATCCCGAGAAATCATTTCTCTCCCACAGTCGCCATCCATGTCACACGGGTACAGCCGCGCCGTATCCAAGTCAT
CCACCAATCAGCATCCATACAAACTCCAGGTCACAGAGGTGACGGCACGTCGTCGGCAATTTTCTGGGGACCGCCTCGTGTCACGATACCCAAGTGTCGA
CTCTGCCATGCCCAAGAAGAGCGCAGGTTTAGCACGCATCTCCAATTTGTTTGCTTGCTTCTCCTTCGGGACATGGTAGTAGGCCGCGCACTCACACACC
TTCACGTTCTTCATGTCTGGTTTGCGATCATTCAACTTCTCATACGGCGTCATGTCCGTCAGAGCCTTGGTTGCACTCATGTTGTCGATGTGCACGACGT
AGTTCAGGATCTCACCCCAAAGACATACAGGCAAATTGGCGGCTTCTCGAATAGCACGGACCTTACTCAGCAGCTTTCCATTGAGCTGCTCCACCAAACA
GTTCTCCTCTGGGGTATACGCGTTGGTGGTGAAGGGCTTGACACCATGCTCACAAAAGAACGTAGCCAGTCGGTGGTTCAAAAACTCTCGTCCTTGATCA
CAGGAAAACATCTTCACGGGATAGTCGTTCTCAAGTTGAAGAATCAACGTCATCTCATTGTCGGCAGCTTCACTCTTCTTGTTGAGCAAATAGACCCATT
TGTAGCGGGAGGCCTCGTCCTGGATCAGCTGGAAGTACTTGGTCCTCCCCCGCGTCTGAATGCCAACGTAGCAGACATCGGACATGAGGCGCGCACCGCA
CTCAGTAGCACGCTTGCCGACTTGACGCTTGAACGCCACCCTCTTCGCCTTTGCTTCCTCGCACGCCATGCACTTGAGTGCTGTCTTCTTGAAGTCGTCC
ATGGTAAGTCCGTTCATGCCCTCAGCCAAACCGTCTAACTCCATCTTCTTCATGGCCGCTTCATTCAGATGCGCAAGTTTTAGGTGCCACTTCATCACGA
TATTGTCCTCGAGGGTCTCCACCGAGCGAACAACCATCATAGAAGCTGTCAGTACGGGGATTGCCTTCATCCAATAGAAGCCGCCTCCTTTCTTCTTAAA
CTCGAGACGAACTCCACCCTTGTCGAAGTACTTACACCGCAAGCGCTCATTGTCCGTGTCAGAGTATGAAGGCTTCCAGCTCTTCTGTTCAAGCAGCCTC
TGACTGACCAAATTGACTGTCCCTCCAGGTGCATACCGAACTGCATGAACTTGCCAGGCTGCACTTCCAAACGGACCAGACCCGAGTACTCGTTCGTGTC
CACACCTCCCTGCCAATCGAGAGTCACAAGTGGATCCTTGACCATTCGCACGAACGAGCCTCCATGCACGTAGGCATGAGCTCCTGCCC