Description :
From Genome Similarity Track
Location :
Scaffold_138:43213- 57149
Transcript NameFunction/comments
g18581.t1hypothetical protein
g18582.t1RAW34115.1 hypothetical protein PC110_g9546 [Phytophthora cactorum
g18583.t1OWZ18522.1 hypothetical protein PHMEG_0007369 [Phytophthora megakarya
g18584.t1POM78261.1 Hypothetical protein PHPALM_4226 [Phytophthora palmivora var. palmivora

Sequence
13936 bases(100 bases per row)
GGTGGCAACGACCAACTTCACCTTCAGAAACTGAAAACGTTGAAGGCGTCGACGCTAAGCGTGAGTTGAAGCGGCACCGCTGTTTGCCCGAGTATCGGCG
ACATGCAAATCGGCGAGATCATGAGGAGAAGCACGGCCGACCAGCTGATACGCACTCACCTTCCGGCTGTCACGGTTGCTTGGAGACCGTCCCACAGTGA
CGTGCAGATGGGGGAGCCACGTTGAATCAAGAGATGTGGCGGCCGAGCCGAGCTGCCGCTCACTCTCGACTTGGCGAAGTAGCGAGCAAGCTCCGTCGCC
GCCATCAAGGAAGACGCCGCAGGTTCAGCTGTCGAATACTGGCCATGCCCCGGCAGGACTTGGTGCCGTCCTTTTCGGACTCGAACTCCTCTGGCCGGTA
CGACCTCCGAAGACTGAACTTCATCGTCGTGTCCGACGCAGCATTTGACATTTCGTTTGTTTGCCTCCAATTCCAGAGACTCCAGCGAAACCATGCACGA
CAACGGCGGCCAGTTCCCTTTGCCGGACGACTATTTCCCGGAGATCCACTTGACGTCCAAGGAGACCAAGAACTACGAGAAGCAGATGCAGGAGATCGTC
AAGAACGCGCTGGCCGAGTACGAGCTGCACGAGGCCAAAGGCTTGAACCCGGTCTACCGCGCGCCGTGGACTGCCGTCAGTAAAGTGGAAGGTCTCACTA
CCATCAAGAAGGAGACGCCCGACAGCCCCACGGCGAGCCAGGCGCGCATCTTCGGCCGCATCAACGGCGACTACCGCCACTTCATCGACTTCTTCTATGC
CGAGACGTCGGCGGAGCTCTTCGCGTGGAACCAGTTCATGTTTGGCTACGCTACAGACGCGGCCGTGCTCAAGAACATCCACACGGTGGCGTCCAAGAAA
AAGTGTTTGTATATGGGCATCAAATGGACCTGTTTGAGCCCGTCACCGCTCGTGAAGAAGCGCGACAACTGCTACATGGAGTACCTCATCTACACGAAGG
ACCTACGCGGACGCGACGTGGGTGTACGCGTCACGCTGCCGCTTGATATCCCGGAGTGCCCCGACCTGCCTAAAAAGCTCAAAACCAAGCGCATTCGGCT
CAACACGATCTGGATCTCTCGACCTGCCGACCGCGAGCCGAACGTGACCGAATTCTTCATGCTGTCGCAAAACAACTTCAACGGACTCGCGGTGACCGCC
AACTACTACAAGCGCATGATGAACATTCTTATGAACATGGCGGTCTTCGTGGACTCGCGACGGATTTTGATGCAGGGCGTCGTGAAACGGGACAGCTGGG
CCAAGTCGGGCTCTCGCAAGAGCTGCAGCGTGTGCTCGCGCAAGTTCGGGCCGACTCGACGTCGCCACCACTGCAGACTGTGCGGAGACCTCATTTGCCG
ACGATGCGCTATTGTACGTGACGCACCCAAGGAGGACGAGACGGGTAGCGCGTTGGGGGCAAACCGGACTTTTGCGATCGTCAAGACGAAGTTCTGCGTA
CTGTGCGTGACGAAGATGCGGGAGTCGCGTAACAACGTGCTGGTCCCGGTCCCTGCGCCGAGCGGCAAAATGTCTGTCATCGACTGTGAAGACTTGGATT
TGGGAGACTCGGTCGTCTCCGAGACGGAGTCGGAGGGCGGCCACATTTCTTTTTTCTCGACTGGAAGCAGCGAAGGGCGGTCTCTGCAGCTATCGCCGCG
GTCAACTTCACTGTCCTCCGTCTCGTCAAGCCTGGGCAAGATGTCCTTCATGGCTAGGCTGGACGTGATTCAGGATAAGGAAGTCCCGATCCTGGCAGAC
CCAAGGATGACTACCGACGAGCTGATCGAGGAGGAGGTAACAGAGGTGATCGACACGACAGATATGATGCCGGTGTCGTCGCTCAACTCTTCAAAGCCAA
GTGGAGGCTCGCCCAACCAGGACGGCTCCAGCTGGTCTCCGCTAGACTCCAAGACCTCGCCGCGATCTCTTGACCAGCGTCTCGCTGAGCAAGAAGACCT
GCTACGACGCATGATGCTGTCAGCCAGCGGCTTGCACCGCCAGAACAGCGCGAACCCAGGCAGCGGGTGCAGTCCTGGCGGCATCCAATCGTCCAGGTCA
CGCCCAGATGTGACCCTTTATGAAGGCTAGCAGCGTTAGCCTGCAGGCCTGTCTGCAAGAAGCATATAAATCTAAACGTAAGTAAAAGTTGTTGGAATGC
GTCCTTTAAACCGTGTTGCTCCCGCTCGATTCCTCGGCCTTGCTGCTCGGGATTGCGTTTGAGATTGGGGTCGGCCACCGAGCCAGCACCGCTACGATTA
CGTCCTGCCCGAGGTCGAAACTTGACCTTCGCCACCTTGAAGGCGGGTCGTTGCAAAGCTCGTATCGGCGATCCTGGCGGCTTATAGCCACGTGTTGCCA
CGACTTTCGCTTCAATGCCTGCTTGACAATAGCAAGCCGATTCGAGACACGCATTTCAGTGGTGGTGGCAGCTTTGATGGTGTGTTTCGTTCGGGCTCGC
GGCACTGCAGCAGCGAAGTCTTTGCATCCAGCAGGAGCTTCCTGCCAGACGACTGCAACCAGGTCAAGCGTTGCGATCCACAAAAGCCATGAACCGGCTT
CCGTGAAAGGGGTGAGTATCGCCTGAGACGCGCGAGCGGATCTCGATCACGATCCTTCGATCGAACGAGCCGTTTAACGCCGGCAAACAGCATACCGCTG
CTCTGTGACCGTCCCTCGCCTGGGAGTCTAACGCAGCAGTACCATACAAAGCACTAGCACCCGATCTGCTTTTGCAGTCCTAGGAAACAGCATACCGGCG
TCGTCAGCGCGAAAAAATCAAGCCTCTGCGTTGTACGACGACCGTGAGTGCCTCGGCGTCTCAGCTCCATCGGATGGAGTCCGTTCGCTCTTGCCGTTGG
GATCAACACTCAACATTTTTTCACTTGCCAGATCGTGTCGTTCGTTCGGTCCGCCTTACCAAGAACCGTTGTGGCTTCAGTCCACTGTTGAGGCCTCCAC
GACGGAACGACTGGGCGGGGTTTTTATTGCCGCTCAGCGCTCGTTACTCTTCAATCGACGCCATGCCCCGCAGGTCGTCTCCTTCCATGCCGCGGACGAC
GTCGGTCAGCTCGACGGCATCCACGTAAGTTGCGCTCGTCATTCGAGCAGCTTTCTGAAGTTTGTAACGGCCGGATACCTTACGGTTTTCGCTGCTCGTC
AAGCGTAGCTTCTGAGACTGACAACTCGCTGCTGTGCCTTGACGTCAATACAGAATCCGGTCCGGAAAGCTTCACTTCCCTCTGCCAGATGACTACTTCC
CTCCGGTGAGTCTCTCGCTCACCCAAGTGCAGAAGTACCAGAGCCAGGTGGAAGAAATGGTGACCAAGGCCTTGGAGGAGTGCACCGTCCACGAGGCGCG
GGTCGCCGGCTTCGGACTGGAGGAGAGGCGCTGGCAGGACGTGGCGCACGACGCGGACCTGTCCATTGTACGCCGCAAGCTGGGGCCTAACACGATCACG
CGGACGTTCGGAACGGTCACGGGCGACTATCGCCGCTTTGCTGATTTCTTCTCGTCGCGCACGTCGGAGCAGCTTTTCTCGTGGAACCAGTTCTTCTTTG
GCTGCGCTGTGGACGCCGTCGTGCTGTGCAACTTGGACTTGGACAAATCCGACAAGCAGGCGAGCCTAGGTATCAAGTGGGTCTGCTTGCAACCGTCCAT
GCTCAGCCGAAAGCGGGACGAGTGTTTTCTCGAGTACGTTGTCTTTAGGAAGGACGAGCAGGGCCGCGACGTAGCGGTGATGGTGCGCAAACCTATCGAT
ATCCCAGAGTGTCCTCCACTCCCGGTGGAGATGAAGACGAAGCGTGAGGCGATCACGACCGTGACGGTTGTCCGGGCGTCCGATTCCCACCCGAACGCAA
CCCAAGTGTTTATGCTGAGCGAGTGCGAGAGCAAAGGACTCACTGCTTCTACCAAGTATTGCCGAAAGCTACTGAAGGCACTGAAGGATATTTCACTATC
AGCCGATGCCAAGCGCATCGCGTCTACCATCAGCGGTCCTGGGTTTATGGAGCAGTCACGCCTCGGTGAGCCTCTGCCTACAGGAGATATCAAGCCTTGG
GTACCCTCCGGCATTCGGCACAGCTGCACTAGCTGCTCACGCCCATTCCGCGCTGGTCACAGACGTCGCTACTGCCAGTTGTGCGGTGACGTCTTCTGCT
CCAAGTGTCTCGTTCGACGCGCTGGTATTCGCCAGGAAAAGAGCGCCTTCAGCAACTACATTACCATGGCCAACCAACGTACGTTCCGGGTAGCACACGC
GCTGTTCTGCAAGGCTTGCGTCTCTCGTTCTCGCGAGGAAGACGCAGAGGCTATTCAGGAGCAGATGGAGCCTACCCGTCGCTCCGCAGCGTCTTCGAAA
TCGTCCTCAGTGCCTCCCCGCTCGTCAATGGGGTCCTCTACACAGCCGCAGAGCTCTCAGTGCTCAACTCCGGTGTCCTCGGTGCCACGTAGCTCCCAGT
CCCACCAGACTGACGCGCCTCGCTCTAGTGCAACCTGGGGTGACGAGAACCGCGTGTCCTGGTGGTCTGAAAATGAGGCCGACACGTGCAGCTGGAAGTC
TGGGTCAAGCCGATTCAGCAGCGTCTCGCGCAACCACAGTGGAGCCCCCACCGTGCGCTCATCCTTCAACTCCGACTACTCGCTTCCGAGCAGGAACTCC
TTCTTGGCGGTGCAGTCTCTGGGGACACCCCGTGAGATCGGCGCCGCAGACCGCATCGACGAGCGCTCAAGTATCTACGAGGTCATCGACACCAAGGATA
TGGTGCCCGACGCGAAGCACCAGAAGCAGCAGCAGGCGTTTGCTTCGGAGTCGACGGACGAATCGATGGACGGCGATTTCTACAGCGATCTCCAGGAGGA
CAGCACCCGTGCTCGCTACACGTCCGTGCCCGTGGCCCCGACGTTCCTGCCGCCGCGCTCAACTGTCCGGCGCACTCGCAGCACCGACCAGAACGAACCA
TCCGACTCGACGACCAAGTCGTTGGACCAGTGTCTCGCGGAGCAGAACGAGCTGCTGCAGCAGGTCCTCTCCGCCAGCCGCGTCTTCAACCCCGACGTCC
AGGCGGGGTCCAAAGCGTCTTCCTTCAGCAGCAACAACAGTATTCTCGAAGACGACGACGATGGCCACGATGACAGCGTTTATGAGCTGTAGTCCACTCC
ATTGAAGTAATGTAGACAGAGAACCCCATCGCGAAAGTAGCGATGCTAGTAAACCACTCGGCGCAAGATTCCGAGTACACATTCAAAATACACACAAGCC
ATAGAGGTATCAATGCAGAAGTTATTGCAACGCCATTGACCTCGGTTCAGCTCAGAGTCCGTCAGCAAGCGTCGGTGTGACCCGATCAACGAGTTCGCTG
TGCACGCCAACCACGCACTTGGTGTCGCAATGAAAACGTGTGGCGAGTGCTGCGAAAGAGGTGGATTTGCAAGTGACTCCATTCCGACGGAGTTCTGTGC
ACGCCGCTCGAGTCAAGAGCGTAGGTCTGCGTGGGAGTGCACTTTAGGCATGGTGACAGCCCACTCGTGTGCTGCCCGGCAGACGAAGGCGAGGACACAT
CGTCGGGATACGATTGGCGAGGCGCGAGTCATGCCATCTTGTGGCTCCATCTGTCTATACGCATCCCAACTGCGTGCGCAGCCACCTCTCGTCGATGAGG
CCGAGTTGCACGGCCCGCATTGCTCAACTTCCGCAATGTTTGCTGCGACCTCGACCCAGCCGTAAGTCTCCAGTTTTTTCGCGTCCGTGCACAATCAATA
ACACGCCATGTGCCTCAGGTTCGCCATGTTTGGTGCTCGAACAAGCAATCCGTTCCCCGTGCCCGACGACTACTTCCCGGATGTCAAGCTATCGACGCTC
CAGGTGCTCGAACTGGAGGAGAAGATGGCGCTCGCGGTCAAGAACGCGCTGGCCGATTACAACCTACACGAAGCCATGGGCTCGAACCCGAGCTACGACG
AAGGCTGGAAGACGCTGGGCAAGGTCGCAGACCTCACCGCCGTACGCCAGGTGGGCGACGCCGCCAATTGCCAATGCCGCATCTTCGGGCGCTTCCAAGG
AGACTACCGCAACTTCCTCAACTTCTTCTACGCAGAGACCTCGAGCCAGCTCTTCGCCTGGAACCAGTTCATGTACGGCAACGCTGTGGACGCCGCCGTG
CTGAAAAACATCCACACGAGCTCGTCGGGCAAGCCGTACTTGTACCTGGGCATCAAATGGACCTGTCTACAGCCGTTCGCACTCGTCAAGAAGCGCGACA
CCTGCTTCCTCGAGTACATGGCCTTCACGAAGGACCTGCGGGGCCGAGACATTGGCGTGCGCGTGAATATGCCGCTGACTTTGCCGGAATGCCCGCCTCT
GCCCGATAAAATGAAGACCAAGCGGATGCAGATGCTCATCGTGTCTATCGTACGCCCGACGGACGGAGATCCTAGGTCGACAGAGCTGTTCCTCACGAGT
CAAAACGACTTTGCGGGTTTCGCGGTGCCCGGGTTCTACTTCAAGAGACTTATGACCAAGATGAACGACATGGCCGTTTGGGTCGACTCGAAGCTCATCT
CGGTGCACGGCATGATGAGGCGCACTAGTTGGGCGGACAAGAAGGCGCGCTCCGAGTGCCGCTTGTGCTCGCGCGATTTCTCAACCACACGCCGCCGCCA
GCATTGTCGGCTCTGCGGCGAGGTGTTTTGCCGCCAGTGTTTAATCTACCGCGGCGCACGGGAAGGCGACGACACGCAAAAGACATTTCAAGTTGTCAAG
ACCAAGTTCTGTCGCGTGTGTGTGGCCAAAGTGCGTGACCTGGATGTGGCGTTGCTGGCGCCGGGCTCGCACAGCAAGATCGAGGATAAGGCAACTACGC
TCAGCATGTTCGCGGACTCGGCGGCGTCGACGAAACTTGACGGTGAGCACACTTCCCTTGGGTCGTACGCAGATGTTGTTGATACGGACTTGTTGGTCTT
GCCTCGGTCGTCCTCCGGTTCTGAACTACTCGAGACGATTCGGTCGTCTGGGGAACGTGATGGTGATTTTGTAGATGACGAGCTGCAGGACGAGCTGAGG
CTGAAATCTATGGGCGTCGACATGTCAAACCTAATGTCGGCGTCTCAAATGATGCGCCGGATCAACGCTGGAGCCTCCTTCGACGACAAATCCGCGCACC
AGCAGCCCGACAGCTCCGGCAAGATAGAATCAAGGCGCACCATTGACCAGTGCATCGCCGAGCAAGAAAACCTGTTGAGGCGATTGATGCTGGCCGCCCA
GGACAGCCATAAGCCTGCAGCGCTTTAAGATCTCAACCTTTATTGCATTGTTGTCGCGACGGAGCAAGTGCAGCTGCGTTGGATAGTCGCAACGCACGCA
CGAAGTTCGCCCGTCGTTCATCAACTATAGATTCCGATTGCACGGACGAGCGTGCATGTACTTGTCTTGAAGTGGCGTTCGCCGTAGTAAAAGATTTTTT
CTTAATCCTCGTACCCGCATGGTGTTCACCGGGGCCGATGGTAAGGCGGTCGCAGCAAGTTCGGGTTGCACCGCGACCAGAGCAAAAGCTTCACCGGTGT
CCTGTCTCGACGCTTCCAGTCATTTTGTGATCGCCGGGGCGGAACTTACAACACCGGAGCATTTGCCGCCGATTGTAGAAGTGCAATGGCGTTTCTTGCT
GCTGACTTGACCTCAAGCCGCTGGAAGGTTTTGCACTCTTTGCCATGACGATGCAAGAAAATGTTAAAGTGTTGGTGCAATCTCTTCTTACGAGCAACTA
GACCACTGAAACATTGATTCAGTAAATGGTAATACACTCGACAGTCCTAACACTACGTGATGTACGTGGCTACCCTACACGGGAAGCCATCGTTAGTTGT
TGTTGATTCCTTGTGGTTCGATTATCCGCGGGCGTTGGGTGGGCAGTACCCGGCTGATGAGTTCGCCGCCATTACGAGGCGCTTTAACAGCACTTCCTGC
TCCTGAAGACACTGACCGATCGATCGAGAGGACCCGAACAGGGGCTGCTCCGCTAGTATCCCCCCGTTCAGCGGCGTATCATCGAGAGGAGACGACACGA
TCTGTCGGGTGGCAGAAACGATCTGGTGGGGCTCGTCCTCCACCTCGATCACGTCGTCTTCCTCCATAATGGGTAGTTGGCCGCTGGAAAACCCTTCTTG
TGAGTCACCGTCTGCAGTCACCGGAGATACAAGGCGAACGGTCTGGAAGTCCAGCGCCGCGAGGGACTCGCGCATTGTACGAAGTTCCTCCTCCTCGACC
TCTTGAACCACACGCTCCGCTCCAGCCATGGTTCGCAGGTGACGCAGGTCAATCATCATGGGAACAACGGGCTCCGAGACCTCCTCCACCTCCACTTCAA
CCTCATCGTCTAGTGAAGACGACACGCTGGTCTTCGTTTCAGACTGCACCTCCGAGCTGATGCTGCTCGAAAACTTCTGAAGGCTTTTGCTTTCCTCATC
GCCGCCATCCTCGTCAATGCCATCTTGCGGTGGGGCGGAGCGAGCAGAACTGCCACCGGTAGGCGAGAGAGATGCGATTGACGAGCCGCCAGTCATTGTG
AAGTTGGTATCGTTGTCAAAGCTTCGAGTGCGCGACTTGTCCGGGAACCAGCTCATGGACTCGGCGTCCGATACGCCTTCGTCCTGGCTGTCGCCGCTGG
TGATAGACTTGACTTCGCTGCCTCGAACCTTGCCCATGCAAGCCTTGCAGAACATCGTCTTGACAACTTGGAATGTCCGTGGCGCCACAGTAGCGTTATC
ATTCAGCAATGGTGCATCACGAATTATCATGCACCGACGACAGGCCACCTCGCCACAGAGACGGCAGTGCTGCCGGCGTCGCGTGGTTGAGAACTTGCGG
TTGCACACAGTGCAGTTCGCGCACGCCTTCTTGGGCGCCCAATTGCGGCGGTCCAGCATGCCTTGCATCGAAATGCGCTTCGAGTCGGCGAACAGCGCCA
TGGAGCTGAGCGTCGTCATGAGCTTTTTGAACGTGGCGACCGATGAGGACGTGGACCCCTTGTACATGTCCACCTCGCTCGTCATGAAGATTTGAGTGGC
GTCGGCGTTGTCGCTCTCCGGTCGAACGATAGTCACTGCGTGCGAGTGAATCCGCCGGGTCTTCATCTTTTCCGGCATGGGCGGACACTCGTCCAGGAGC
AGCGGCAGCGTGATGCGGACGCCGACGTCTCGGCCCTGGAGGTCCTTGGTGAAGACAAGGTACTCAAGGTAGCACATATCGCGCTTGCGTGAAAGCGTCG
ACGGGTCCAAACAGAGCCACTTCATGCCCAAGTACATGTGGGGCTTGTTGGATTCCTTCGTGTGGATGTTGCCCAGCACCGCTGCGTCCACGGCGTATCC
GAACATGAACTGGTTCACAGCGAAGACCTGCTGGTCCGTCACCGAGTAGTAGAAGTCGAGGAAGCTGCGGTAGTCGCCGTCGATGCGTCCGAACACGCGC
GAAGCCTCGACTGCCCTGGAAGGATCCACCTCGCGGATGGCAGTGAGATGCTCGACGTTTCCCACGACGGTCCATCGGGAGCCGTAGTCCGGTCGGGCGC
CCATGGCCTCGTGCAAATTGTATTCGGCCAGAGCGTTCTTCATGATGATCTCGACGCGCTGCTCGTAGCATTCGATCTCGGCCGGCGTGAGGTTCACCGG
CGGGAAGTACCCGTCCGGGAGGGGGAACTTGCTGACGTTCATTGTCGGTGTTGCACTGGTGCACTCCATCGAAGCAGCACAAGCAAACTGACACCAAACG
CTCCTTTTGCACTGTGTCGGCACGCAGATCACAGCCAACGCTCGTGCGGAGCGCTGTGCGAGGTTGTGCTGCTGGCCCGTCCACCGTGTGAAATGCTGCA
ACGCTGCAATCGTCCTTGCATTTTGCACTTGCCATCGCCCGCGCCTTTCGCGTCGAGGCGCCTCTATGCATGAGCAAAGCAGACAGACATCCGGATTCGT
GGCGGCGCCGGGGAAGCGAAGGACGAGATTTGCAAGCCGAGCAAGGCGGAAAGCTCGATCGATCACCGGCGGTGATCGACCGGGATCCGGCCACGAAAGC
TCGCTGCGTACGGCTCTGCAGGCCTTATTAGTCGCGCATGGAGTTCCTCGCCGGTCTTGGATTCCGTCCAGAGAACTGGTTCCCCCTCAACCACTTCACG
TGCTCAAAGGCGAACATATCACCATGCATATGCTTGCCTCTACGGAGAGGAAACAGTGAAGAAGTTGGCCGTCATCATTCACGCATCGATGCGCTCGACT
TTAGTGATAAGGTTACATGTACAACACACAATGCACGGTTGCAGATGCTGCTCAGTATCGAGCACTACGCGTTGGCGCCGCACTCTGGTGGGATATTGGC
GACTTCAATATCGCCGCGTGTTAAGCGCCCACGTTTGAAATGAGTCTTCGCAAACCATACGGCATAATGGCGTCTCGGTGTTGCTGCTGCAGCCTCACCG
AGTTCCAGTCTGAATCCATCAACTTCATCACGAAGACTGTCTTCATGCCATAAGCGCACTCATCACCGGTTTACCTTGTCTTTCATTGCGAGTCTCCCTG
CAATTTGTAGGAGGAGGTACAAACACATCGTGTCTTGCAGCCTGGAAGAGTCATGACGTGTTTGTACCTCGTCAGGGTTACCCAAATAGTATTTGAAATA
CGCACCGTTCGCGATGAACTTCGGTCCGTGGGGAATTCGGCGACGCCATCAGAAGCTGACAAATTGCCTCATCCGTCTTCGGCCGCCTTGCTGCCAGCAA
GTTGCTGGTTTTCCTGGCAGGAAGCTCCTGGGACTTCAGGAACTGGCTGGAGAGAGGCCGAGGAGACTAGCACAATGCTGGCAGCACGACCGCCAGGAGG
GATCAAACGACCACGTCGTGTGCGGTGCGCTCGCAGTTGGCATTTGCAACCTCTTCCTTGTCATCTGCACGAAGGACACATCGTTTTGGTCTGGATGGTG
GTCTCAGAGACTTAGCGAGTTGAGGAGTTGCGCGGCTGTAATGCATCGAGCACTTGGCCGCCAAGTTGACGCGCGACTCGCACCTCTCCATCACTTCCAG
GCTTTGGCCATTGCACACAGCGCATCTTTTACCCGGGTGTGCGGGATTCGTGGTGCTGCTTTGCGTCGGCCACAAACGCCGGCACAAACACAGTCCACAT
CGGACTGTATCACCGCGCCGCCGGGCGAATGCTTATTTACTTTGAAGTGTAGTTTTTCGTTGGGGAGTGGTACAGTATCTACCAAGGCGTATGCACGGAC
GACCCAATGCACGTGGCGAGAAGCACTCGAACTTCGGATGCATCTCGCCATGTTTTCGTGGTTTGCCGCATATGTATTGACCCTCTAATGTACGTGTACG
GCGAGCCATGAAAAAAAATGACGAGTCGTGGCCACCACAAGATCACGTGCGACCAACAAGCGCTGCGAATTTGCGGATACCGTTGCAGGACAGCTGGCGT
GCTTGCATTGCCCCCAAACTATTGAAGCCATGGGCGCTCGTGGCGGTCTTCGCCCATGTATCGCAGGCTACGCAGTCTAGTCACGGGCGTAAGTGTCCGT
GCAGTGCTTTTGAGCCATCCACTTTTCAAGCGCGCTGCTCCGGCTACGCTCGAACATGTAAGTCGCGACTTTTCTGAAACACATCGCTGGTAAATGTCCC
CAGCTGGACCTACACGCATCCGTCTCTCGGTGCGAGTCTTCCGGGTGACCGCTCAAACCGACTGCCGCTCTCGGAAGGGATCTCGCAAACCTTGTTGGCA
ATCGCGCAGGATTGGATTAGTTCTCGATTTGCCGTCATGCTGTCCTCGAGACGCAGTCGCACCATATCTCGGTAGGTTTGGACAGCCAAACGCTGACTCA
AACGCTGCATTCCACGCCACGGTTTCCGATAACTAACGCATTGCTCATGCTGTCGCTTCAACTCATGCCAACAGGAACGACGCCAAGACGTTCCCACTGC
CCGATGGCTTCTTCCCCGAAGTCAAACTGTCCGATGAACAGATTCAAAACTACGAGTTGCAGGTCGAGAACATCGTTCAAAACGCCCTGAGCGAGTACGA
GCGGCACGAGGCCAAGGGGGCCTACCCGATCTACGGCGAGCCGTGGGTGTCGGTCGGCACCGAGGGCCCGCTCACTGCAATTCGACAGGAGACACCCGCA
GGACTCTCTCACAGCGAGTTCCGCATGTACGGACGCATTCAGGGCAACTACCGAAATGTCATGGACTTGTACTACGCCGAGACGTCGGAGGAGCTCTTTG
AGTGGAACCAGTTCATGTACGGATACGCTGTGGACGCGGTCGTACTGAAAAACATTCACACGAGAGACTCCGGCAAGGCGCACGAGTACATGGGCATCAA
GTGGGCGTGCTTGCAGCCGTCCGCCTTTGGTCGCAAGCGGGACAACTGCTTCTTGGAATACCTGACCTACACCAAGGACGAGCTTGGGCGCGACGTAGGG
GTGCGTGTGACCCTGCCCGTGGAGATCGAAGAGTGCCCAGAGCTCTACCGCTCCTTGAAGATAAAGCGGGTCAAGACACACAGTGTCGCCATCGTCCGCC
CCGCAGGATCATCTTCGGACGCGACGCAGCTTTTCGTCATGAGCGAGAACGACTTTGCAGGGTTGTCGGTGCGTGCCAAGAACTTCCGCAAGTTCATGCG
CATCTACAACGACATGGCCCTCTTTGTGGACTCGAAGCACATTCTGAAACAGGGAATGGTGTGCAAGACGGACTGGGTGCCGAACGACTCGCGCAAGGCA
TGCACGAGCTGCCAGCTCCCGTTCAATGCCGCGACTCGCCGCCGGAATCACTGCCGACTGTGCGGAGACATATTCTGTCATCGCTGCGTGATCGTCCGCA
ACGTTCCTCGCAGCAACAAAGCAGATAGCAAGTCGCGCATCTTCCAGGTCGCCAAGACGCACTTCTGCAAAGCGTGCGTGTCTTCTATTCGCCAAGGAAG
CGAATCGTCAACGAGTGCGTCGGGGCTCGTGCGTGCGTCTTCGGCCACACACGTCAGCAGTGTTGGCAAGCTCAGCTCCGAAGGCAACGGACGCACACTG
CGTAAAGCGGTGAGCAATACTAGCGACCCCAGCAGCTCGTGGGACCCAGCTATTTCTCAATGGTCCGAGTCCGACTGGTCTGAGACGGACTCCGAGGACG
CCAGCAAGGCGTCGCTGAACGCTTCTGGCCGATCGAGGCTTGCCAGCTCGCTGTCTTCGTCGCAGTCCTCGTGGACGATTGACACTCGCCCGGACGACAC
GCTGGAAAAGGACGAGATGTCGTTCGTGGCTACACTAGATGTGATTGACGATGAGGTTGCAGTGCTCGACGAGAAGCCTCGACGTTCCAGGTCCAAGTTG
CACAAGAAGCTGTCGATGTCTGGCCGGTACTCGATGAGTCGGAGGCAATCGACCCGCAAACAGCAGAAGGCTGAGCCAGTGACGGAGGGGCAGGAGGTCA
CGGAAGTTATCGACACGACGGACATGATGCCAATGTCCGAGCTGCGACGACAGTCGAGAGCAGGCACTGTGGGCGTTACGCTGGCTCCGCGGAAGTATAG
CAAGAGACGCAGTGGTCGGGAGTCGTTGCTGAGCTCGAGTGGCCCTTGCCCTGGCCGCCGCCCGAGCCGTGAGGAGCCCTCGAACCGGTTCAATTCGTCT
CGCTCGATTAGCCAGTGCCTTGCGGAGCAGGAAGAGCTCTTGCGGTGCATGCTCAGCGTCAGCCGAGTCCACTCGAACCCGGGCGTGCGGTCCAAGAGAA
GAGCGGGGGACGCGGACAAGGTGGACTTTGCGTCGACGATGCCTGTGCCGCGCCCAACAGTTCGACTGTACGAGATCTAATATGAATGCAGTCGTAGCTC
ACACAGCACCCTACAATCTACTATTTACTGAGCCAT