Description :
From Genome Similarity Track
Location :
scaffold_492:4321- 6479
Transcript NameFunction/comments
Pl_104388hypothetical protein PHYSODRAFT_556110
Pl_104389conserved hypothetical protein

Sequence
2158 bases(100 bases per row)
GCATTTGGCGGCTCGCCGAATGCCGAATGCGCAGAAATGGGTGGGACTCACGGGGCTCACGGGTTTCTACGGTGCACTCATGTACTGCGTCTGGGATGTG
TATTCGTGGGACGTCATGGAGCCGATCACGTACTTCATCGGCTTCACTGCTGTGTTGGGCAACTCGTTCTACTCCACTATCACGAAGAAGGTGCGTGCAG
TGACACCCGATGTGATCATGACACTATTCTAACTGCTGTCATTGTTGCATCCTTTGCAGGATCCGACGTACAGCAACATGTGGCAAAAGCGGTATGCGGC
TCGTGTGGAGATGCTGAGTAAACAGCGCAAACACAACCCAGCGGAACTCGAGGAACTCAAGGCTCGCATTGCTGACCTCGAGAACGACATCACACTGTTG
TCGCAATGGGAGAAGGTGGACGTGGTCAATCCCAACCTGCACTGATCTTGCTTCATCAAAACGCAAGTATCAACATGAAAATGGTGATTTCAACCAACTG
AAGTGAAGCGAACGAAGCATTAATTCCGAGTTGCAGTCTACCATCTAACCGTCCACCTGAGGTGGACATGTTTCCATAAAAAACGTCCAAATAGCTGTTT
AAAATTCTGATACTCTTTTCAACCAATCATCGTCATCTACACCAACTATCCACCAATCAGATGCCATTTTGCATCATTTGCAAACTGGAACACAGCGAAA
AGATCCAAGCGACGATGGCGGCGAACCAGAGCATTAAGGAGCTGATGGCGGCCGAGACGAAGGCTTCCAAGGTCATCAGTGAGGCGCGTCAAGGTGGGCA
TCATGTCACTCAACCTTCATCAAGAAAAATGAAGCTAAATGCGTTGTTAATTTATTATTTAGAACGTGGCGAACGTCTCAAACAAGCGAAACTGGAGGCG
GAAGCGGAGATCACAGCCTACCGCAAACAAATGGAACGTACGTTCCAGATGAACGGCAATACTGACGTAAGGGAAACTTCAATATCCCAGAAAGTTGTGG
GAGAGAGAGATTTTATATTTTTTATGTTGTTTTATTGATTATTGTATATTATTTTTATGCCTAGCTTATGGGAGACGACCCGAGCATTCTTGAGGAGGAG
ACCCAACGCGACATCAAGAAGATGCAGTATGTTTATATTAATGAGTATAATTTTGTAGAATAGTATGCTAACTTTTTATTTTTTATTTTTGTAGGGCCGA
GTTCCAGCAGAACAAACAATCGGTCATTACGATGATGGGACAACATGCTGTTCGTGTGCAGATTCGTGTGCCCGACGCTCGTAAAGCCTAATTGGGAGGA
ACTTGGAAGAATGGAGGGTTGGAACGCCCAGTAAGGACAATTTCCAGTCGAGAGGCTGCTCCCTATTCTCGTGAATCACACACGATTTTCTTGTCTTATG
GATTGACATTCTTCAGACTTGGATGTGTATTTTGTAGGCTATTATTTGTTGGACTAACTTGAACAAGGACATCTGACTCAGAAGTGCAGCCAACTATCTC
CACTTCAACGAGTCACTCGATATATTATCGTTGCAAGTGGCACTTTAGCGATGTACTGACCAACGGAATGTGCATGACACGGGGCTGTGATCGCTGCCAC
GTAACTCGTCATTTAATGCTCGGTAATTGTCTCTCACGGCTTCAGGACTGAAACTGCTGGTGCCTCGACTCGCGTCCGAGCACGCTACCTGTTCTACCTG
GAAACAGTTTTCCCATGGGCCTTCCGCTCGAGAGCAGTACAGGATACGGTCGCACCATCCCGGGACACGTTCACGAATCCTCCCTCCCTTGTAGAACGGT
TCGCGGTAGGTGATTTTGTACACGTGCTGAGCCCATCGCGTGTCTTGTCCCGTTCCGGTGGTGGATCCGCTCAATGGTAGTCGTGATCGACATGCTACCT
TCTTGTAGGTCGGATAGAACGTGGGCCATTTAGATGGTTCACGTAATGCCTTCAAGCCCGGTACGTACATTAAATCATCGGCCATGCTGTCGTATTGGTC
GTGCAGTTCCTGCAATCGACCGGCACTCAGCAGATGCAGCACTTCATCACCATCGAGCGATCGGATGCGATAGTTAAAATCGCCCATCCAGATCACGTGG
TCACTACAATTTGCAAGTGTCGTGTCACCTCTGTTGATCCCTAGTGACCGAGGGAGTT