Description :
From Genome Similarity Track
Location :
Scaffold_1286:432- 6737
Sequence
6305 bases(100 bases per row)
ATGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAATTATCTTCCGAGAGTATACAAGCTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTA
AAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTAAGTATATTTATAGGTAGGTTAAGCTTGGGTTTAATACAAACTATAAGTTACCTATAGAAA
TGCAATGTCATTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCCGGTGTATGACGTGTCATACACCTGAAGTGTGAAGTGTC
ACACTTCATGTAGCCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACCAATCAGAATGAAGAGGTGTTCG
TCACAAACTCTCATTCTCAAATTCAAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCAACCTGTGTGC
TCTTCGTCTAGGTCTCCACTTCGACCGTTATCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACGCTCCAATGCTGCTGCCGGTAAGGCGCAAGC
CAAGAGCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGATCCTCGGGTGACGCGGCTGTGGACAAG
CGCGCAAGCAGACGCCGCAGTCCGTCGCCCTCGTCTTCAGACAATAGTCCGAGCCCTCGGTTCGTAGAACGTGAGTTCAACTCGGGCAGTGAGGACGATG
CCGAGTCCGAGAGCACTCAGGATTCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTAAGCACAAAGATGACAGCGTGCAGTCGCCCGCTAG
TGATCACGGTGATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAGGAAGAGAAT
CCTAGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACAGCCTCTAAGTCTC
CACTCCGCGAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGACTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAAGAGGAGGAGGGTGC
TATCGTTGAGCCCCGGGAGGTCTCAAATGACCTCTACCAGTAGCAGGAGGAATTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGACGGCACCCGTC
AGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGGTCCTCGTCGCTCCTCGTGGCCTTG
TGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGC
GCCACACCGCATTCCTCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCATGACCCGGGGTGGTCTCTATCCTGTTTAGGGATACCCCTGGGTTATGCCG
GAGAACTGTCCCACGTGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCACCCACGGAGTTACGGGAACTCCATGAAGATC
AGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGAATGCTGCCAAGGGACATCCTGAAGCGCGCGGC
TTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCT
GTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAG
CTGTCGCTTACCGCGACACCGTTGCTCATGGAGGATCCGCTCCACGTGGAAGTGGAGCTCTCCATTCCGATCAAGCAGGGGCGGAGGTGCCCTCGTACGA
GTACGAGTACTCGGCGCCTCCCGAGAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTC
CTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACC
TGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGAAACGCCGGGCCTCTTCGTCCGATCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGAGTGGCGACTTTGCGCTTTGTC
CTTTCGCCTATACTTAGAGAGGGAGGCCCAGACTATTCTCGCACTCCCCCCTGCGACAGGAGTGGCAGAGGTGAGGCGCTTTCTCTCGCCGTGCGGGAAG
AGAGAGTGGGGCTTTCCCTTCTCAACGGGCCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTGGTCATGG
ACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCCTGTCCAACCGTGTCGTCCTGCAGCAATGCACACCCGATGG
CGTAATCGAAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGC
ATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAAGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGG
TAGTTGGCCAAACCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCA
CGTTGCTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACAC
TCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGC
AAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAG
TGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTT
GTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCCGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGTTACTTTCCGTTCGGC
TTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGATCTCGCACT
GTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGG
TGGGTGTTTGTTCACCACGTCCGCGTACTCCGTCACCAAAGGATACACCGGATCCTTGAGGCTCTTGAGAATCTCAGAACTCAAGCGCGCCTGACGTTGC
TTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTC
CAGCCTTGAGGTTGGTCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTGCAACCTCTGGCAACGGCTCCAAGTGGACACCAGATGCCTT
GACGGGTAAACCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACG
TCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGACGTCG
TCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAGGGTCTGGGCGAC
CGCGTGTGGCACTGTGTTACCCACACTACACAGAAAACGTGTTCAGCGCCTTCCTCTTCAGTTAGGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCA
CACTACACAGGAAACGTGTTCAGCGCCTTCCTCTTCAGTTAAGGTCTGGCGACCGCGTGTGGCACTGTGTTACCCACACAGAAAGCGTATCCGACGTCTT
CCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAGCTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAAC
TAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCGGCCACCACAAAACATCCTTGATGTCGTCATATACGCCGACGA
CCCCTAAGCATCTGCCGGATGCTTTGGTACCCTGGCGGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCGGTCGGA
CTGCGCAGGGCGACTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTTAAGCCACGGCATGCCCAGGATCATATCATATGGATCC
ATATC