Description :
From Genome Similarity Track
Location :
Scaffold_2235:432- 2716
Sequence
2284 bases(100 bases per row)
ACATGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGTATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACG
ATTGATGATATCCAAGTGGATCCAGGGGCGAACGAGCCCACTGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAG
GTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTT
CCGAGAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCTTCTCTGGTGGTAATCATCGTCAAGA
AGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGA
AGATTTGGATAAAGTGCTCTGGTACTGTTCTCTAGACATGACCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATC
ACACCGTTTGGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCCAACGCCTGATCGATAATGCCCTCTATGGATT
CACCCGAATACCGGAACCCGAAAACGGTGGATCCGGGGAAGATCATACGGAAGTGGATCCATTCGAAGCGAGAGAGCCAGGGGATCCTGGCACCCCGTCT
GTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTTCTGGAGGTGTGTACTA
GGTGGAATCTCTCTATCAGGCGTGATGAAGAGCTATTGGGGAATGCGCAAGGTGGATTACCTAGGTCTTCGAGTTTCCACAGAGAGGGGTGGGAGGCGAA
TCCTAAGGACCTGTCTTCGTTGGCAGACTTGTCCTTCCCACGGTCGCTACGAGCGATGCAATCCTGCTTGGTCAGTTTGAACTACTACAGTCGGTTCATC
GAGGATTACGCACTGTTTGCTGCGGTACTATATGAACTGAGAGAGGTAGATTTTGCTGCGATGACCACTTCAGCTGTCCGGATCAAAATCCGACAAGCTT
TGGCCCTGGTGATATCGGATCCACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGAGACCAACGGAGAGA
GGATCCAGTCTGGATAGAGACGACGGATCAGAACATCGAAAAGGGCAGAATCTCGGTGGATTCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGAT
CGCGACCACACCCATCCTCCGTCATTTCGATCCGGAACGTCGACCTACGGTGATAGTTTATGCCAGTGACTGGGCGGTCTCAGAAGCCTTGGTACAAGAA
CATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACGCTAAAGCCAAATAAACTGAGCTACGGAGCGGTGGAGAAGGAGATACTCGCGCCCCTGC
GCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCGTCCGGATCCTGACTCGACACTCTACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTACA
AGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGGAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCG
AGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCAGATCCAGATTCCGATCCCGACGGTACAAG
TGGATGAGGATCTGTACTTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGA
AGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTACTAAAGGGACAAGATC
CAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAA
AGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGAGATTG