Description :
From Genome Similarity Track
Location :
Scaffold_689:432- 1923
Sequence
1491 bases(100 bases per row)
CCAAGgAGAAGAACCAGGTCGTGTTCATCACCGAGATCATGACcTCAGGCACGCTCAAGTCGTACATCAAGCGCGTGCAGTTTGTCAAGTGGAAGATCAT
CAAGCGCTGGTGCGTGCAGATCCTCGAAGGACTGCACTATCTGCACAGCCAGAACCCTCCTGTGGTGCATCGCGATCTCAAGTGCGACAACATCTTtATC
AATGGCAACACAGGCGACCTGCGGATAGGCGACTTGGGACTCTCCACGCAGCTCGCCGTGCACAAGCGTTCCAAGGCGCAGAGTGTACTCGGCACGCCCG
AGTTCATGGCCCCGGAGCTCTATGACGAGAGCTACGACGAGAAAGTTGATATCTACGCCTTTGGGATGTGTGTGCTCGAAATGGTGACCAAAGAGGTGCC
ATACTCGGAGTGCATTAACCCAGCACAGATCTACAAGAAGGTCACGGCTGGCATTCGCCCGCGTGGCATGCAGCGAATCATCAGtcAGGGCGCGAGAGAT
TTTATTGAGCTGTGCCTATCGCGAGGTAACGGCCAGATCGACGTGTCGGCACAGTATTTGCTCAACCACGAGTTCCTCAAGCCACAGGATGACGACAATG
AACTTGTGCAGGTGCTGGACGAAGACGAGCTGGAGCGGGACGTTCCCCCGCCACCTCCTGTACCGGTGATGAATGCCAGGGCGTTTGCGGACCAGCTTGA
CATGGAGAGCGGCTCGAAGGGGAAGGACCAGACCGTGCCTGCGACGGAGCGAAGAAAGCAGAACGCATCTCTGTCGATGGAGCCGGAAGAGCTGAGCACT
GGCTCGGCCGAGAACTcGGCCCCATCGTCTGGTGTGCAGACTGTGGATCCTGTGGCAGAGGACAAGTCCCCAGGAAAGCACCACGTGCTCGTGCctCCAA
AGACGTTGGCCACAAACGACGTCGCACCTGCTCCATCGACGCTTCCCCCACTCCCACCGCTGCCGCCTCGTGCCCCAGTCGCTGTGCCAGTCGTTGAGCC
TGTGGTCGATGAACCTCTTTCGGATAAGAAAGGAGACCAAGACCACGTCGATACGTTCCTCTCGGGACTTCCACCAAGTGAGGCAAACATCCGGAATCAC
CGAATCGCACTCATGGGTGGTCGGGGACAGCGCATTGAAACGCCAGACACGCTGTACGTCGACGATAATGGGGATGACAAGCAAGAGCCGCCTGCCGCGG
CTCCAGGTCCAGCTGCGGTTCCAgCcGCTGCTCCAGCTGCAGCTTCTCCTGCTCCTCCCACTAGCGATTCCGGCGCGTCACCAGAACCTACaCCAGCACC
AGCACCTCTGCCCGTAGCGCCAAACACCGAGCGCGTGGCAAGTCCCGTGCTGAGTGAGCCACCGCCTGTGGCAGAAaCTCCGGTCGAGCGTCGCGTTCGT
ACCAACACGATAGACAGCACGGGCAGAGGCACGCGTCCTGCATCCGCGCAACGAAGACGTGGCAAGCGATACGACATCAAGGCGTCCAAAG