Description :
From Genome Similarity Track
Location :
Scaffold_615:432- 1573
Sequence
1141 bases(100 bases per row)
CCAGCGGTTTAGCGGTTTAGCAAACCCTAGAAGTACCGTATTTTCTCCATAATATAATACCTGGTGAATCCGATCGATCAATTTCAGCAGGGTATGTGTT
TTAATATTCAATTTTTCACGCCCAAAAACCTTGTAAAAATGATGCCCTGTCAAATCCGTTCATCATTTTTGACAGGATATCAAGTTTCATAAAACTGTAA
AGTAGCATACCTGTCAAATCCGATCAACAGTTTTGCCGGGTTTATTCGTTTCAATAGTTTTATTTTAGTCATTTTCTACCCTTTCATAATTGATATCACC
GTGGTAACTGATATCAGATATATCAGGATATCAGTATACACAGGTGCCCAGGCACTTAGTAATTTGACAGTGATGCAGACCGAAATTCGCAACTTTGAAA
CCGGCTTTGTATACTAAATCGACTACGCTGAGTTCGAATTCGTAAAAAAATCGAACTTTTTGAGGCTCAGTTTCGAGATAACACGTTTTTTGCGTTTAAT
ACAAACTTCCAGTCAACTTTTGAGGATGAAATTTTGGCTGCAACTCTAACTCACGTGTTTACATATGTGTGCAAATTTTCAGAAGATTCCTGAGGCTAGT
TTTTCCAGGGACCCCTCTACTAAACCCTAAACCCTAAACCCTATTATCTTTCAAACCCTACTTTTACAAACCCTATTTTCACCAAAAAATATACTATTAC
CAAATCTTATCAACACCAATATTAACAATTCATTTTTCTTCTTCTTCTACTACCTCACATTACACTACATATTTCACCCTTTCACATATACTCTACCTCT
TTACCAACTCCATATCACTTCTATTTTTACTTTTTCTCATCTTTGCACACTTCAAATACAATACTTCTACATACACTTTCCCTAACTATCACATCCCCAC
CTATTCCACTTTCATCACACTCCACATCAACACCTTTCTTACTCTCTATAACCACCACATCCACCTCACCCCATACTTCTTTCTCATTCACTTACTATGT
ATATCTACCCATTCTACTTCTACATACTCTTCATATACATATACAAACCATTTTCACACTCTCTATACTTACTCTTACTTATGTCCTTCCATCAAATCTT
AACCAACTTCTTCACCTTAAATTATATCTTTATCTTATTCC