Description :
From Genome Similarity Track
Location :
Scaffold_23:431998- 434264
Transcript NameFunction/comments
Sapdi_VS20SDRG_07926hypothetical protein

Sequence
2266 bases(100 bases per row)
GCCTCGATGCGCACAACAACTCGTTCATGACCTTTCGCCACAAGGCGTCGATCACCGCGCTCGCCATCCTCAAGAAGACGCAGCGCCTCTGCGCCGGCAC
GCAAGACAACCTCATTGTCGTCTGGGAGCTCGACGAGTTCACGCCCGCGTACTCGCTGCAAGGCCACACGCGCTCGATCACATGCCTCGAGAACGTACCG
GGTACGCAGGTCCTCATTTCGGCGTCCGTGGACCAGACCATTCGCGTCTGGGACGGCGACCGCGACTTTGCCTGCGTCCAAGTGCTCACGGGCTACAATG
GCCACATTCTCTCCATGACGTCGACCAACGACACGCTCTTCATGGCCTGCCAGGACACGACCGTCAAGGTCGCCAGCGTCTACGCATCGTCGCCGAGTGC
GATCCTGGCGCCGACAACCGAGTGGCAGAGCATGAGCAACCACCACGGCTTTGTCTACGGCATCCGCTACATTGCGCCCGCCGGCAAGAAACCGCTCCTC
TTTACGTGCTCCAGCGACAACTCGATCGTCGTACGTTGCCGTCTTCTCCTGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCGCTGCAACGGCATTCTC
AAGGGCCACAGCGCAGCCGTACGTTGTCCTCGTATTCTTTCAATGTATCAATGGCCATGTAGGTGCTCTCGGTGTGCAGCCTCGAAGACAAGAACCGGAT
CTGCTCGGGCTCGGCCGACGAGACCGTGCGCATCTGGAACACGCAGTCGCTCGCGTGCGTGCACACGCTGCATGGGCACCGCGGCGGCGTCTCGAGCATT
CTCAGCACCGAGATGTTTGTCTTTAGCGCGTCCGAGGACAGCACCGTCAAGGTGTGGGACATTGACTTCATCTCCAACATGCGCCCGTCTTCCAACACCA
CCAACTCGACCAACACCAACTCGAATACGAACGAGAGCCAAGGACCGGCGCGACCGCAGAAGCTCAAGATGGACTCGAGTCTCATGAGCGTCAGCGCCAT
GTACAACAAGCAGACGTCGGACGCGTCCATGATCCACCTCTTGCGCAAGTTTGTGAGCATCCCGAGCGTCAGCGTCGACCCGCAGTTAGTCGATGATTGC
TGGATGGCCGCCAAGTTTGTCAAGGTACCGACACCACGTTTGCGCTGTCTTGACCAAAAGAGCGTAGGGTTTGCTGCGGCAGCTCGGCGCCGAGTGCCGA
CTGGTGCACTGCGGTCCGAACATCAACCCGATCGTGATTGGCAAGCTTGGGAACGACCCGACCAAGCCCACAGTGCTCATTTGCGGCCACTAGTACGTCA
TCGGACATCCTCCAACGTGTAGCTAACCGTGGGAGCGTAGTGACGTGCAGCCGGCAAGCATGGAAGACGGCTGGGACTCGAACCCGTTCATGCTCACGGG
CCAGAACGGATACCTCTACGGCCGCGGTACGACCGACGACAAGGGCCCGATCATCGCGACGCTCTTTGCGATCCGAGAACTTATTGCGCGGAGCCAAGGC
GGTCGAGCGACCGAGACCGAGGGTGATGCCGCTGCGTCATCGACGAAGCGTCCGAAGCTCTCGAGTGACATGCCCAACTTTGTGTTTTTGTACCAAGGCG
AAGGCGAGAACCAATCGCAGGGCATTCGCGAGACGGTCGAAGACAACTTGTCGTATTTTGGCCCGATCGACTTGGTGTTCATCTCCAACAACTATTGGCT
TGGCGACACGACACCGTGCTTGACGTACGGTATGCGTGGGTGCCTCGAGATCCAGCTCAAGGTTGACGGGCCGGGCGTCGACCTCCATGCCGGCGTCGAC
GGCGGCGCGATCCGTGAGCCCATGTTGGATGTCGTCTCGCTGTTGAACCGCATCGTCGACCCGACGACCGGACGGTTTACAGAGCCAGCGTTCTACGCTG
CCGTGCGCCCCGTCTCGGAGGACGAGATCGCGCTCTTCGAGTCGCTCGAGTTTGATGTGGACGCGTACAAGCAGACGCTTGGCGTGCCAGCGCTCCTTCC
GGCCTTTGGAAGCCACGGAAAAGCGTCGTTCGTTGACGTGCTCATGAACCGCTGGCGCTTCCCGGC