Description :
From Genome Similarity Track
Location :
Scaffold_7:431988- 433474
Sequence
1486 bases(100 bases per row)
TACACCATTTCCTGGCCAAAAATGCCAAGTTACCAAGCAAGGTGCAAAGGATAAGAGACAGGGATACTTCAAGTGAATAAAAAATAGATTATTCAACTTT
TGCAAAACGAATGGGTATACATTCCAAACAAAATGCAAACTCGAAGTCACGCGCCCAGCTCCAAGTCAAAGCCCCTCTCCGCAGCGAAGACGTGGCGCAG
GCAGTGCCTCTCGTAGCGCCAGATGAGTCGGTGCGTAATGACACTCTTGCACGCTTCCTCTGCTTCTTTCATCAGCGCCAATCTGTGCGACATAAAGGAG
TCATACTCCCCACGACCAGAAACCCCTGCTTTCGTCCTGCCGTGAAACACCGCATCTTGGCCTTCAAGGAGTTCCAACACCCCTTTATGGGGGTCAGCAT
CGGGCTGTAGGGCCCCAGACGCAGAATCTCGAGCTTGTTCAGGTTTATAATCCCGTCAGCAGCCAGGTACTCTCGAGCAAGGTTCTCGATGTCGTTGTGG
GACGGTGCGTTGTCCGTGACAATCACAACCTTGGCCGGTTGAAGTTCCGCGTATTCCTTGGAGCGAAGAGCAGCGATGAAGAGATCCGCCATTAATCTTG
CATTCTCGGCCTTCTTCACGGACCCTTCGTGGGTTTGCAGCAGAAGTAGACCAGAGCCACTTGACACCCCTCCTTGGATGAGGAGGTTCTTGCCTTTGGA
AGGCGGCAGTTGGACGACCCCAATCCGAGCCCAGCTCTCATTCCGAGACAGGTACAAATTAAAGTTAGTTTCATCTTGAAATACAATCAGGTTACTTTTC
TTGATGTGCTTGTTCAGCTCCAAGACAAAGGTCTTGCGCTTCTCCTTGTTGGCGGATGAGTTCATAGTCTCCTTCTCAATGCGTAAACGCTTCGTCGAGT
ACAGCATGCCCTGTAGGGCGCGATGAATGGACGTCTTGCTGACAATAACGCCCAGCTCGGCTTGCAAGAGGTCAGCTATTTGCTCCAGGGTCATACGGCG
GTCCTCGTCGAGAAGTTCTTTAATGTTGCTCATCACTTCAACAGTCATCTTTTACAGAAGCTTGGCGCAAGCCGCCGCGCTGCTTAGGCTCCTGTCCAGC
ACAAAGTACAGTCCGGCGTGCTGTAAAATAGTTGACGTCGTTAGCCGTGGCAACATCCCTCCAATTCTGGTTCTCCTGGAAGGCACGGACGACGCGAATT
TTGGCTTGCGCTCGCTCGAAGGCGCGGTTGGTCTTGTTGGGTTGTGGGGGATGTCATCTTTTAAAATGAGCGGAAAAGCTCACTCGTGTGGCGCGGTATC
CGCGGAAGCAACTGGCAATTCGCGCCAAAACGACTGGTTTGCATTTTGCTTGAAAAGTGTACCCATCCAGTTTGCAAAGAATGACAAAAGCACTTTTTGT
GATTGTACACAAAGCATCATTCTTTCAAACTTTGCAGTTTGGTTGGTAAAATTTGTTGTTTGGCCGGGAAATGGTGTAGATATTCG