Description :
From Genome Similarity Track
Location :
Scaffold_174:4319- 7487
Transcript NameFunction/comments
Sapdi_VS20SDRG_16983hypothetical protein
Sapdi_VS20SDRG_16984hypothetical protein

Sequence
3168 bases(100 bases per row)
TGGGCCAGCGCGGCGGGCGCGGAGAGCCGAGGCACATAGCTCCGCCGTGGACTGTACGTCACAGCGAGCTCGCTGGTCGCGCGAACGAAGCGCGACTCGA
CGTTGGCGCAGTCGAGGAACTTGCGTAGGAGCGGCTGGAGCACGCCGAGGAGAAAGGTCGGCGTCGTGACGAGTGCGGCGTCGTCGTACAGGGCCACGAG
CGCCGCGACGAAGCGCCCGAGCTGGCCCGTCGCCCATGGCAGCCACTCGACGCTCGGAAATGGCAGCGTTAGCACGTGCCGCAGGCGGCGTGGCCACGTC
GTCTCGTGGCTGTTGCTGCCGACCTCGCTGGTGTAGAGCGTCCGAAGCGTCTCGCGGAAGAACTCGAGCTCGACAAAGGTGCGCGCGAGGTCCCAGGACC
CGAGCTTGGCATGCAGGCGGAAGACGTGTTGCTTGGCGCCGCCTGTCGTGGCGCGCTGGGTGCAGCTCCACTCGGCGTGCTTGGCCAGCGTCGGCGAGCT
CAGCGCCGAGAACATTGTGCTTTGAAAATATTTATTGCCACTCCAATCAATACAAAGGTATTAAGTCGAGAAACCGTCGCATCCGGATACCAGAGGTGAT
GGGCATCAGAGCACAACCGTTGACCTAAGCCTTTGACCTTGGGCTAGCAGTCATATGGGTTCACCAGTGCATAACAGATAGCCCATGACATTGATACGTC
GCTCTTCTTGGACGAAGGCACCGCCCAAACGACGCGCGGCACAGGAGCTTCCACGTGGTACCGCGTACATTTCAGTTGGCCTATGCAGAGATGTTGGCTT
GCCAATTATGGCTTGCGACACCAAGGGCGTCTAACGACATCCTAGACAAAGAGCAAGGGCGTGAGGCCGAGGAAACAAGGTCGACCGATTTTATAACGAG
CAAAACGTGCGACTGGCAGCGTATGAGCAACGACATCCAGGAGTAACAACTTGGACGTTTTGGACATAGTACCTCGGTGGCAGCACGTAGCGCGTCAGTC
CTGGTTCTAAGTGGAACCAACACTCTGGTTCTGGGGTGGCAAGCCAAGCTGGATGGCGACCGCCTATGGTTGTTGTGGCTTCGGTATCAGAGCTCATATA
GCTTGTGCTCGCGCCGACATCGAGTTCTATCCCTGTGCTACGCCGTGTTTAGACCGGTAGCATCTCAAGTTCGGACGAAGCGAACGAGGATGCATGACCT
TTCGAAAGCTCTCTCGACACTGCACACCCCACCACTCGAGCTACCTCGGATTCCATACTTTGTCACAACCAAGGGTAGCGTGAGTGACACTGACCCATAA
GCTTTTCTACACGAGGCTTGTAGACAGGCTACAAAGTTCACGCTGGGTTCAGAAAAATGTGGCACCAGCAGTGCGAGGCCACTCTGAGAAGGCATATCCA
CGACACCATCACGAGATGCCATTGCCTCGCAGATCCTGCACGGTGTTGTCAGTCTCAGGTGCAGGATCGCTCACGTGCACAGACACAGATTCTGGCGCGC
TGGTCGTGATGGCGACGCACTCGTTGGCGGTCGCTGCGGATCGAGGCATCGAATGTATTCGTGTCAAACTTGCCCAGGGTGGGCGAGGTGGGTGGGCTAT
TTCGTTGCGAGTTGCCAAAGACGGACTAGAACTTGTTTTGCTGTCTGGTTCTTCTGTTCTTGCGCCGGAAATCTTTGCGTCCCGTCGCACTCGTTCTCTT
CTGGAAAAGGGTGGATGACGCACTCGACTCCGGAAACTAGTCGATGACGCTCTCTACTATCGACAACGCGTCCGATAGTACGAGCTACGGCGCGTGCACA
ACCCCAACCTTTTTAGGTATACAAAGTATACAATCCGCACAGTACAATCGTATCGCAAAACGGGTCGTAAGAAATCCAGGCGCGATCGTCATGCAGTATC
TGGATACTGTACTCGAAAATAAAAAAATCCAAAACCGTGGATTAAATCCAACGGGACGTCCGATGCGGCCAACTGTCTGGCAGTTGAGTCCTGCCATGTG
TGACTCGGTCTGTCGTGTCCACTTAATAATGTCCACGAGACCTACACCGTAGGACGATGCGAGCCCGTTGCACCTTCAATGTCCTACCCACCTGCCCTCG
GTTACTCTCTCGGTTGAATTGTGTTTGATTGTGGTGCTCTTTGGGTGCCACCTCACTTTTCGTTTTGCTCGACGACAACACTCAATTTCCAATGGCTGCA
GTCTGGACGTACACGATTCGCCAGTGCGAAGGCGACGAAGCGACAAAGCTCTACTGCTTTCAGCTTACGGTCGGCGACGTCTCGTGGTCCGTCCTCAAGT
CACTTCAGGACCTCAAGTACCTCCGCCAAACGCTTGCCACGTTGTACCACAACGAAGTCATCAACGCCAACGCCGAAGCGTACTGGACGCTGGAGCTTCA
GAAGCTTCTCAAGCTGCCCGTGCCCACCGCTGCGTGGATGCCGTGGGCCCCAAAGAAGATGGAGCGCGCAATGTGTGCTCTCCTCTGCTTTTACGAACAC
GCGATGGCCGACAGTTCGCCCCCGAGCTTCCTCTTGCACGTTTTGAAAGGGCTCTTGCGCGTCTTCCTCGGCATGCCGTGCCACCCCGACCGCTACTCGA
TCCGCGCCTCGGCTATGGTGTGCCCCGTGCTGGCGGCCCCCAAGATCCTCGCCTAACCGCGCAAGGATACGACTATAACTTAAATATAAATAAATGAAGA
CTCCAAGAAACGCACTAGGAGGCTCAAGTAGCCATTTATAAGGGGAAAACGAGTTGCCAAGCTCGTACGTGCAGGCATAAAAGACAGGAGGCAACGGTTG
GTAAATGCAAAGAAATATTCAAAAATGTAGAATTCCTTTCCGTTTTCAAAGGCCCTCTTTTTTTAATGTGATCGTGTGGCTTTTCTGAGCGACAGCAATA
TTACAAGAAAAAAGTCGTGAAAGAGGAAGTAGGTGGTATCGAAGTGCCGACCAAACGTTTTAAACGGTAGCGTGCAATGGACACCGTTTCAGGAATCCCT
TCGGGGATCATCCGTAAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCATAAATCGAGAAGTATCGCACTTTTTAAC
TTTTGGATTTGCACTTTTCAACTTTCCGATTTGCTGATTTGATACTACCTTTTTGCACGGCTGCAGAG