Description :
From Genome Similarity Track
Location :
contig_23:431828- 433620
Transcript NameFunction/comments
g6383.t1hypothetical protein

Sequence
1792 bases(100 bases per row)
TCCTACACTGCAGGATAATTTGCCCACTTTGCGACGTTCCGAGCCATTTAAACAGCAACGTGGAGGATCGGCCTTTCCGAGCCATTATTATTACAGGAGG
ACGGAGGTCATGCGTCGACATCATTTATCTTTATTATAAGCTTTGGAGAGGCTGTGAATGGGGAGAGAATTACCCAGCTGCACGGGGCACGCCCGCAGCA
CGGGATCGACTCCATCGTCCACGCCCAGCCCGATCAAGACGAGTCCAAGTTCAGGTAAACCCTGTCGGTGGACCCCCCATGCGTTTCGTGGTGGAAATGC
TGAAACGAGGTCTTCAGCATCACACAATACCAATCGCTCAAGGACATCGCAAGGATAATGGGGGCCGACCGTCGAGTATTTTGGCCGCATGGAGCAGGAC
AGTAGACTATGGATTTCTCGCGATCAAGCTGCACCTCAGAAGCTCATCGATTTGCTCGACGGCGCAGAGACCTCAGTGGATATTGCTACGTATATTTTGA
CGCATCCTGAACTGACAGACGCTATCATCCGTGCCTCCAAGCGTGCCACGGTTCGTGTTCTCGTTGATCGGGCACAAATCTCCGAGACAAGCTCAGCTAT
GATAAAAAAAAAAAAAACTGATCGAAAACGGGGTCAACGTTCATTTCACGCAAAGGCCCCAAACTCATGCACTGGGAGATAGCGATTATCGACGGAGACA
TATTGACGATGGAAAGCTTTGCAATTGGAGTGTGGGAGGAATGACGATGAATTGGAAGCAGACTGTTGTATTGCGTGGTCCTATTGTCGGAGCACACGTC
GTTGAGTATGACCAACACATGTGGTCTGTTGCCTTGCAAAACAACTGGAAAGTTGAGATAGATACCCGCGGTAATTTTCATCACACACAAAGGACCTGGG
GGTTTCTGCAACTCGAACTGTTGCGCTTTTGCACAATCGCCACAATAGACGGAGCTGTTCTGCGTGGCGGCTTGGAGCTTCGGCCAAGTGGCTGGCTCAC
GAGTTTGTCTGCGGTGAGGACGAGAGAGAAATGGAGAGGAGATGAAGGTGCTCCGAGGTTTTGGGGATCCCGAGTTTTGGAGTTTTGGATCCCCCGGTGC
TGCACTGCTTTCGTCCGGACCGGCAAGAAGGACATCAAGGTCGTCTGCGAGGAGCACCCGGGCTGGAAGCGACGGACGGTCGCCCATTACTACGCTATGT
ACGAACGAGGGGAGAGCTTGCAGCTCAGGTGTGGCGTTGTGGCACCGGTAGAGCATTGTGAAGGCACTTGCAGAAGGCTGCATCACTCGCATGATCGTCG
ACGAGCAAAGCGCGCTCCAAAACAAGAAAAACATGACTTGGCTACGCAATTTCAAGGACGCGGGGATCCCGATCAAGACTGGACGCGTGGCCAAGCTTCA
CGGTCCACAACAAATGGACGATTCGTCAACAACGAGTTTATTTTACAAGGCACAGGCAACTACAGCACGGTCGCGTTCGATGGAGCCCGCCATGCAGAGA
CATTTGAGACGCGCACGGCTCAGGCGCACCTTGATTCGATCAAGCGTGAGTTCGAGCTGCTCTGGGAAGAAGGACGGGTGCTTCAATGGGCCTCGAAGTA
TTCTGCTTGCTTCATGTACTTAGTAGGATGTGGTTGAACGTGCGCGCCATTGTTCAGCAGATGCCCATGAGCGAAGTCAACGAAGGCATTCCTATGATGC
GTGAGGGCCGTGGTGCGCTACCACATCGTGCTGCGCGACATCAAGCCCGTGTACAAGAAGAAGTTCGGCAAGAATCTGCGCGAGTTGCTGCT