Description :
From Genome Similarity Track
Location :
Scaffold_9:431781- 433385
Transcript NameFunction/comments
Physo_129833hypothetical protein

Sequence
1604 bases(100 bases per row)
CGATAAAAAATGACTCCAGCGATAGTAGAGCAGACCCAATCACCAGCGCGAGCAAAACCACAGCACGCACATTCAGCGAAAGGTTGTGCCACGGGTTGCG
CGAATGAAACCAAGCTTGAAATTCTCGCATTTGCTGGAGCCGCGAGGCATACACGGACGTAGCGTTGGGCTGCCCCGCCTCCGCACTAGCCTCTACCCCA
GCGCGAGCCGTAGTTGACGATATGTATTCGGATGTTGCAATCGGAATGGTGACTTCATCCGCTGGAGTCTTCACGCGTTTTTTCCTGTCTTTGTCTGTCT
TGTTGAAACAGACCCAGCGCGAGGGATGCAGCGCGATGCCCACGTGATGGACGAAGCGGAAGCCTACATCCAAGAGCCATAAGTGCTCCGCACGCTTTTT
ACGCTCGAGAGCGCTCACAGCGCGGCGCATGATACGCCTCCGACGACGGTAGTTGCTGACAATGACGCGCATCTTCTTGTTTCGGCTGCTCCAGAAATGC
GCTATCATCCACAGCACCAGGTACCCTCCGACAAACCAAAATCCCATCTGCACATATGCCAAGAACGCGTCCGACAGTGACCAAGACGTCGCAAACTTCA
AGACCATTGAAGCTGCCGTCACCACCTCGAACAACACTGGACACACAATGTCCACGATGACAAACGTCGACAGGTCGATGGCTGGGCCTTCATCCTTCAC
CTTCTTGATGAGCAACGTTGTCTTCACTGCAGCGCGGATCCGCTTCCAGCGGTTTCGCGCTCTTGTTTTCGGGTCCTCCTCATCCACAGGCGCCAGCCTC
GCTGCACGAGCTTCCGCCTCCTCCGCAGCTGCCTTCCTCCTCTCGTCCTCTGCCTTCTTGCGCTCCCACGCTTCGTCCTCCTCCTCCTTGTCGTCATCCA
AGAACGGGTCGTCCTTGGCAGCCAGCAATATGGAGCCTCTCGGATGCAGTAGTCCGCCAGGAACTGCACTCGTCCGACTTCTCCGCAGCTGGTCGCCGCC
ATCGCCAGCGGCACCGTCGTCAGCTGGTTGGTCGTCCGGTTCTTCCGGCTCCACCAGCTCCGTGCGATGGCGGATGTAGTGGATGACCACGGCCAGCGCC
AACCGGAAGTTGGGCAGCGAGCCGTCGGACTTGTTGAGGGCATCGAGGAAGAGTCTCGACGCCTCCTCGAAGATGTAGGACAGGAAGAAGAGCACCACGG
GCAGCAGCACCAGCGAGATCACCGCTCGCACGGTGTAGTACTCGTCGTACTTGGCGCTCGGCAGGAAGATGGCGAAGAAGATCTCCATCAGCAGCGTGAA
GGAGAACATGAGCACCATCATGACCACGAGGAACGACAGGTAGCCGAAGCGCACCTGGCACAGCGTGCGGTAGAAGCGCCACTGGCCGGACGACTCGCTG
TAGGCGTGCAGCTCCTCCTCGCGGCCCTCGGCCGTGGCCAGCACGCGGTCTTTCTGCTTGTAGGCGTCCACCAAGCGGCCCGAGTAGCCCATGGCGGCGT
CACGCATCATGACGTTGCGGCGAGGGGTGCTGCTGGACGTGGCATCGAAGTGGTGGTGATGGTGGAGGTGCGGGTGCGTGGTGTCCACCGAGACGGAGGA
CGAC