Description :
From Genome Similarity Track
Location :
contig_141:43176- 44386
Transcript NameFunction/comments
g11666.t1hypothetical protein

Sequence
1210 bases(100 bases per row)
TACCGATTTTCGGGTTGAGCCTTACCAGAGAGATACAATGAGCTAGAGAATACTCCTGTTTAAGTGCCTGTTTGTCCAAGACAGCTTCTTCGTGAAGGAA
AACGTCCAGAGGCCACATGCCCCCGTTGTTGTCACGTTGTAGAAGTAAGTATCACTGTATGGCACAGGTTATGATGCAAAAGCTCTGCAATCAAGCCGAA
TCCCGGCTTTATACACTCGGGTGTGCAAAGTCGGGTTCACGCGAAAAGCCGCGGCCAAAATGCCTCCTGGACGCGCCGGCACCGACATTCGCGCTCTAAT
AACTTGCACGTCAGAGCGATCCTGAGGACACGGGCTCCACCATTTTAAATGTTTAGTGAGTGTCGATGCGATGACCAAATTGCAGAAGCATCGAGCGATT
ATTCGCAGAGTTAGCTTTTGACCGCACTCCGAATAAGGGGCATTTCCGGTATGTGTTTCTCAGTCATTTAGTGTTAATTGCTTCGTGTTATTAACAGAGA
GTCTCCGTAAGAACTGGGCAGACAAAGGGGGTAATTGCAAAGTGAAAAAATCCGGAAAAGCACCAATGGTGTCAAACTTGGCACACATACTCACCTTTCC
GTCTTCATCAACATGGTCACGTGTGGTGTATCAAGCCTGTGCCGTTGTCCTTCATATCGACGTCCAGATGAACTCATACTCTTTGCCATATTAAATGACG
TTGTGTGCATTTTGAGGGTCGCAATGTCCTTCTTTGTGTATCTTTGGTGTGGAAGCGGCTCGCAATGTCCTGCTTTGTGTACCTTTCATGTGGCGCGGTC
GTGGCATCACCAGAGACATGGGAGATAACGACGAAGCTACATGGCGATCAGCTACATGTGCAGCAACGGAAGATGGCTTTAACGCAACCTTGTCTGCACG
ACAGCATGGTGCAGACAGGTCGGCACTGAGGTGACGAGTGACACGAAAAATATTAGCCTCGCGACTCCCATCCGCTCACCGAAGATACCTGACCGATCAG
GATGAAGAACGCATTCAAATTCTCGTTCGCGAGCGCGCTGAAAAGAACGCAAATTTCAACTTTGACGAGCTTGCCGTACTTGTTCACGCGACAGCCACGC
GCAATTCTAAGGTTACCGCAAAATCATTTCCAAAACGCAAATGGCTAAATCGTTTCCTTAGAAAGTATCCCGACCTTCGTGAATTAGTTATCCCAACGCG
ACGCAAAACG