Description :
From Genome Similarity Track
Location :
contig_1:431759- 434689
Transcript NameFunction/comments
g126.t1hypothetical protein

Sequence
2930 bases(100 bases per row)
GGCCTTCGTTGAGGGACGCATGGGGAAGCCGCTGGCTAAGAACTCGAAACTTTGCACTAAGAAGTATCACTAAATCATACCCAGACTAAGCATAGAAAGC
CATCAATGCACATTAACATGTATTCCTCCTAGAGTATTATGGGGGGGGGTTAATGAGGTCCTCTATTTGTGTTTAACTAGAAACTATAGAGCCCTGAAAG
TCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGATTTTAACCCAATGTTGATGTATCGAGGCCGAGGTGAACGGCAGATGAACTTTACGGAAGCAGGA
GAGTCACCAAGATCTCCCGCCACGGTGGATCACGATAATCGTGCAACACGAAGGCTCCACCAAGTCCTCCGCGTTTTGGTGGGCAGACTTGAACACTTGA
GGGTCACCACGTCCTCAGTGGTTTGGTGCTGGATCAGAATCGCTACGGGGCACCAGGTCCGTCGCGATGTGGTGGGAAATCTTGATCACGGGAGGGGTCA
CCATGCCCTCCGTGCCTTGGTACTTAAGCAGCTGATGCTTGAGCTGTCCGAGCGCGAGGGTGTACCATGTCCTGGCGCCTTGGTAGATAACTGGAACACT
GGAGGGGTTACCGGATCCTCCGTGCTTTGGCAGCGAGATCTTGAACGCGATGGTCCGCCAGGTCCGTCGCGGCTTGGTGTGTGATCTTGTGTACACGCAG
GGGTCACCAGGCCCCACATGCTGCAGCGTAGTTGATAATCTTGGTGGTATTCGCCAAGCACGGCGCTGCTTCCGCGCCCGGCGTACAGGAACACCCCATC
CCTTCTTCTCGGCCCCACGCGGGGGACTTCGCATCCGAAAAGGGGGATCCTCCGAAGAGGCTTCCGGAGACCACTTTAGCCAATCGGCGCGAATTGCGAA
GTGGTCCTAGAGTCTACATCCATCTTGTAGGCGAGGGGACCCACCTCCCCCCGCGCGGACGCCCTGCACGCATGCGCCGCCCCGCGCCGCCCCGCTGCTC
CTGCCGCTGCATCTTGTAGGCAAGGGGACCCGCCTCCCCCGCGCGGACGCCCTGCACGCATGCGCCGCCCCGCTGCTCCTGCCGCTGCATCTTGTAGGCG
GGACCCCCCCCCCGCGCGCGACGCCCTGCACGCATGCGCCGCCCCGCTGCGCCGCCCTGCTCCTGCCGCTGCATCTTGTAGGCAGGGGACCCCTCCCCCG
CGCGGACACCCTGCACGCATGCGCCGCCGCCCGCTGCTCCTGCCGCTGCATCTTGTAGGCAAGGGGACCCGCCTCCCCCGCGCGGACACCCTGCACGCAT
GCGCCGCCCCGCTGCTCCTGCCGCTGCCGCTGCTCCTGCCGCTGCATCTTGTAGGCAAGGGGACCCGCCTCCCCTGCGCGCGGACGCCCACGCATGCGCC
GCCCCGCTGCTCCTGCCGCTGCATCTTGTAGGCAAGGGACCCGCCTCCCCCGCGCGCGGACGCCCTGCACGCATGCGCCGCTCCCACTTGCTTGCCTGGC
TGCTTCTTTTTGTGTGTGAGCCCACTCATGTCGTTTTAGCCAATAAGAAAAAATATATTTTTGACCAATCAACACGTGTAGGCACGCTGTCGGCACCGTG
TCGGCACCGTCACGGTATGGATGAATATCATCACGGTGCCGACATATTATTTTTACTTTGTTTTAGTATAGGCAGTGTGGACGTGATAACAGCTTATTGA
CCAATGACATCTAGAGACACTCAACGTCGACCAATGAGAGTAATTAGGTGTAGGGTAACACGACGCCGACGCCGTGCCGACATATAATGTAGGCACCGGG
GGGGAAATATGCTGACCGCCAATACAAATCACCAGTTCATTTCATATCTCTCGAATATTCGCGCTCCTGCCGACAGAACACTCCAACTCAGTATGAGCCT
CCAAGACCTTGCGCCAGTCAACTCCCAGCGCGCTCTACAAACCACTATCAACGCATTTGGGCGCTTTCTTGCGGCAGAAGGCGTCTCCATGGGCTTCATC
GCTGCCTCTCTCATCGGAGATGTGAGTGGGGCTGTGTTCGTGAGGCTCATGGATCGCTTCAATGTTCATTTGGCCTTCGTTGAGGGACGCATGGGGAAGC
CGCTGGCTAAGAACTCGAAACTTTGCACTAAGAAGTATCACTAAATCATACCCAGACTAAGCATAGAAAGCCATCAATGCACATTAACATGTATTCCTCC
TAGAGTATTATGGGGGGGGGTTAATGAGGTCCTCTATTTGTGTTTAACTAGAAACTATAGAGCCCTGAAAGTCGCTGGGGGCGTCGAAGCCCAATATCTC
TGTGGGATTTTAACCCAATGTTGATGTATCGAGGCCGAGGTGAACGGCAGATGAACTTTACGGAAGCAGGAGAGTCACCAAGATCTCCCGCCACGGTGGA
TCACGATAATCGTGCAACACGAAGGCTCCACCAAGTCCTCCGCGTTTTGGTGGGCAGACTTGAACACTTGAGGGTCACCACGTCCTCAGTGGTTTGGTGC
TGGATCAGAATCGCTACGGGGCACCAGGTCCGTCGCGATGTGGTGGGAAATCTTGATCACGGGAGGGGTCACCATGCCCTCCGTGCCTTGGTACTTAAGC
AGCTGATGCTTGAGCTGTCCGAGCGCGAGGGTGTACCATGTCCTGGCGCCTTGGTAGATAACTGGAACACTGGAGGGGTTACCGGATCCTCCGTGCTTTG
GCAGCGAGATCTTGAACGCGATGGTCCGCCAGGTCCGTCGCGGCTTGGTGTGTGATCTTGTGTACACGCAGGGGTCACCAGGCCCCACATGCTGCAGCGT
AGTTGATAATCTTGGTGGTATTCGCCAAGCACGGCGCTGCTTCCGCGCCCGGCGTACAGGAACACCCCATCCCTTCTTCTCGGCCCCACGCGGGGGACTT
CGCATCCGAAAAGGGGGATCCTCCGAAGAG