Description :
From Genome Similarity Track
Location :
Scaffold_191:43174- 47192
Sequence
4018 bases(100 bases per row)
GACGCCGCCACAACGTAGTCTTCGCGTAATGCGAGGGCGAATGCTTCCTCGAGAGAGGAAGGTTCCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCAC
GCATGCCGAATACGAATACATGGACCTGCGATGCTGTGTCAATCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCAT
AGTCCTTTTACCTTGACGAAGGGCGACGAACTCGGCACGCACGCGGGATTCGTCTTGAGGTGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCC
AGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCCTTGGCCTTCCCGGACAACCGGGACAATAAGAAATTGATCTTTGTCCCTT
GCGCTTCGATCATTCTCGAAGCGATCGCGATGTCGATCTCGCGAAACCACCGGCTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTC
TAGCTTCACGACATCATTTTTCGAGGAACGCGCGGGAGTTGTTGCTCGCCGATTCGCATCGGCTAGCTCGCGTTCCATGAACTCTTGGGCTGCTTGGCGT
TGCTGGTCGGACGTCGCTGAGCTTAGCAGCGACGTGATTACAGCCTCACCAGACACCGCCGCGAGGCGGTGAAGGGCTTCCCACTCGACACGAGTGAGAT
GAGGGAAAGCAGCATGTTCCAGGGTCGGCCCTGGAGTTTCAGACGTCATGCCTTGGCTCATCGTGAACTTGGTCATGGGAAGGACTACAAAGTGCTACCA
GGTGTAACGGGCCTGGGGCGTCCGTTACTTGCTTACACGTAGTGATGAGGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAATCGG
AGAGTCTTCAATACAATAAGACGCCACATACAAAACTAGTTCAGTCCAAACGTGTATCATACCAGATATTACCTCCTGGGCACCGAGCAGCCTCCAAGTT
GTCAACGAACAACTGTTCTTTTTGAACAAGGGCTCATTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAATCTCTAAG
AAGAGGTCAGCCCCAGAGCACTCCTCGGGAGGCCAATACCCCCTTGAGCTGATGGCAGCTCCTTGACTGACGGGTGCCGCCACCAAACCCCCACGCACAC
GCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGACGAGGTCATTCGATATCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCCTCTTCTCCCTCCTCCTC
CTCTTCTCCCTCCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTAATAGGAGTGTCGAGTCTCCTCCTCCTCGCGGAGTGGAGACTTAGAGGCTGTA
CGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGACCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTGATCGC
CACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCGGAGCGCACAGAAGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCAC
GCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCC
GAGTTGAAGCCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGGGCGACGGACTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGT
CACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCAGT
AGCAGCCTTAAAGCGTGTCTTAGCACCGCTCTTAGCAATGCCACGAGGCTTGATTAACGGTCGAAGTGGAGACCCAGAAGAAGAGCGCACAGACTGCTGC
TCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATT
CTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCA
GGTGTATGACACGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAAACGACATTGCATTTCT
ATAAATAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAAAT
AAAGAGGAGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGATGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGAGCGC
CTTAAATAAATGAATGCAGTTAGAAAAAAAATGTCTTGCTTTGGAGTATTAATTGTGACTAGTATTTTCTTGATCGTTAGGACAGCGTAATGAAACCTCA
TTTTGAAGTGACTACGTAGTAGGATTTAGTGATGGCATGGATAACTTCTTGTAATAAACACTGCCGTCTCGGACGTGCAAAAAGTGTAGTTTTATACTGT
ATTGGCGGTCGTAATACATGTATGTGGCAGCTCAATGAGGCAGCCAACAAAGTTCGACCTGCAACTTGATGCTTAACCCTTCTAACCCGGTATTCTGTAT
CCTACAGAATAAAAGATTTTGCAGGATTTAGTATCCAGCTTACTTGGCTGCAGACTATGAATTCGCATATGATGTTTTGTAAAGGGGGAGTTTGCACATC
ATTCCTATTGGATTGACGAAGGGAAGATAGACGGGGATTGTTCTACGTGAATAGAAAGAGCAATATAAATTCAGTGGAGGTTTGAAAATTTGAGTGAAAG
CCCAAAACGACCGCGTGTCAGCCACTCCCTCATCGCCGCACATTGAAATCTTTCTTCGAACGATGAACACCCCCGGCGAGAAGACGTTCAAGCCGCTGTG
GAGAGAATTATGCAAGGACGGGTGAAAGACTCGCAAGCCCACGCCCATGGCCAAGCATCACCGCTACGTAAGCCTGGAATCACGGGCCGGTTGGACGAGT
CACGACGCAGCATCGACTTTTTTAGGGTGCGTAATTAGACCTTGATATATGGTGCTACGTACTAACAGGATACGTAATGTCTAGGTGAAGATGAACTCAT
GACATTTGGGCGTGCATCCGGCTGCCTCCAGCTTCCCCATTCAAGTGTGAGCATTGCATCTACACGCCGTCCGATCGGAAAGCAGGCTTCAAACGAAGCT
ATTGGTCGGCAGCTACCATACAGCGATTTACCAGAGGCTACGCAGCCCAAGCCACCTTCTGCGACCCCTACGACTGTGGTGTAGCGGGATCAGCAAAATC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN