Description :
From Genome Similarity Track
Location :
Scaffold_36:43169- 46112
Transcript NameFunction/comments
Albla_Nc14036470predicted protein putative

Sequence
2943 bases(100 bases per row)
AAATGGCGCCCAAAAAAGGGAAGAAAACGAAAAGACCAGCAGGAAATGAAGCCAACAAAAACGCTACAACTGACAATGATCTAGACACGCTGCTGAATGA
GTTCACACCTTCTCCAGACGTGAATAATGACGCACATGAAAAGGCAGCAAATGAAGCAGATACTGAGGCTCCCAAATCATCGCAAAACACCGCAGACGAA
ACAGAAGCAGCAGCAGCCGCATTTCTAAAGTCAATGGGGGTCGATGCTCAAGCTGCAAGCTCAGAGAAAAAGGACAAAAAGAAGAAGAAACCCAAGAAAA
AAGCGGCAGCGAGCGAAGAAAGTCATCCCAAATCTAATGAGAAGAAGCCTCCATCAGCTGCTGCCAAGTTGTTGCTCGAACGTCAAGAAGCCATCCGTGC
TCAACAAGAGCGAATCGAGAAGGAACGACTCGAACAGGAGCGAATTCTTAGAGAGGAAGAGGAGAAGCGGCTTGAGGAAGAGCGCCGTCTTGAAGAGATC
AAAAAGAAGAAACGGGAAGCAAAAGCCGCAAAGATTGAGCGACAGAAGAAAGAGGGAACCTACATGACAAAAGCTCAGAAACAGAAAGCGGCGAAAGCAC
AAGCAGCTTTGGAAGCAATGCAACACTCCAATAATGTGGTCGTTGGGAACAATGAAGAGAAGAAGAAAGTCGTTTATTCGAATCGGAAAAAAGGAAAAGC
CGTTGTGGATCAAACGAAGACGGATTCGGAAGGAAAGGAAAAGGTTGACGCTCAAGCAGAAACAGTAACCGTGGAAGAAGCAGAGCCTAAAGAAAATGAA
GAAGCTCCCAATGAAGCGGAGGCTCCAGATGCTTGGGACAATGAAGATTGGGAATCCTCCGAGATCATTGCTTCTCTCGAAGACAAGCTTCAATTGAATG
GGTCTGCGGATGGAAGTGAACGAAAAGATGACGAAGTGGAAGATCTCTTAGTTGTTGAGCAGAGGAAAGAAAAAGAGATTCTTCGGCTTCAGGGAATTGC
GCTGCTGAAGCGACAGCAGGAACTTAAAGAGGTGCAGGAACGTCAGGCTGAGGAAGAGCATATCCGATCAAAAGCACAGCAAGAAGCCGACAGGAAGAAA
CGTGAAGCAGCAGACCGACGACGAGTTAGGGAAGAGAAAGCTCTTGCGAACGTGTCGGCTGATGATTTGCGATCACCGATCTGCTGTATCATGGGTCATG
TCGATACAGGGAAGACCAAGCTTCTGGATAATATTCGCCGGACCAAAGTACAGGATGGTGAAGCTGGTGGAATCACGCAACAAATCGGGGCAACCTTCTT
CCCCGTTGAAGCAATCAAACAACGAACGGAACGTCTCGCTAAAACCATGAAACTAGAGTATAGACTTCCAGGTTTGCTGGTGATCGATACGCCAGGTCAC
GAGTCTTTTACAAACTTGCGATCGCGTGGTACCTCTCTTTGTGACATCGCCATTTTGGTTGTGGATATCATGCACGGTCTTGAGCCTCAGACTTTGGAAT
CCCTTCGACTGTTGCGTCAGAAGAAGGCTCCATTCATTGTAGCCTTGAACAAAATCGATCGGTGTTATGGCTGGAAGGTAATGGCCGACATGCCAATTCA
AGAAGCGTTAAAGCATCAGAACGAACACGTTATTCGCGAATTTGAGGATCGTACCAAAGAAATCATTGTAGAGTTTGCAAAACAGAAGCTCAACGCCGAA
ATCTACTGGAAAAACAACGATTTGGCACACACAGTCTCACTGATCCCAACTAGCGCTATATCCGGTGAAGGTGTTCCCGACCTACTAATGATGCTGACCA
AATTGTCACAAGATCGAATGGCTAAATCGTTAGCGTATGTGGATATCTTGCAATGTACCGTGCTGGAGGTAAAAGTGTTGGAAGGACTCGGTACCACAAT
TGATACGATTTTGGTGAACGGGAAATTGAACGAGGGCGATACCATTGTCGTTTGTACTCTGGATGGCCCCGTTGTGACTCACATTCGATCACTGCTGACT
CCACATCCAATGAAGGAGATCCGCGTCAAGGGAGAATATGTGCATCATTCCACCATGAAGGCGGCAATGGGCATCAAAATTTGCGCTAACGGTTTGGAGA
AAGCAGTTGCTGGCACACAAATTCATGTAGTTGGTCCCGATGACGATGTCGAAGAGCTCAAAGATTCTGTCATGTCCGATTTGACTGGTATTTTGGATAG
TGTGAAAGCAACAAAGCGAGGAGTTATGGTACAAGCATCAACACTTGGGGCTCTCGAAGCACTCCTCGAATTCCTTCGGACTTGTGATCCTCCCATTCCA
GTCGCATGTGTGAATATCGGCCCAGTACACAAGAAAGACGTCATGCGGGCGTCCGTCCAATTGGAACACCAGCCCGAATACGCGACCGTCTTGGCGTTTG
ACGTAAAAGTCCATCACGATGCAACAGAATTAGCTCAAGAGCTGGGTGTCCGGATCTTCACCGCCGATATCATTTATCATCTCTTTGATCAATTTACGGC
TTACATGGACAACTTCCGAAGTACCCGGCGCGAGGAAGTGGCCGATATTGCTGTGTTCCCGTGCGTTCTTAAGATCCTCCCAAATTGCGTGTTCAATAAG
AAGGATCCCATCATTCTGGGCGTCGACGTGGAAGAAGGAGTGTTGAAGATCGGAACTCCGCTCGTGGTCCCAAATGCGGGAATGTTGTTCGTAGGGAAAG
TAAGTTCAATTGAAAGAGAGCACAAGGAAGTGGATCGCGCCAAAAAAGGAATGAGTGTGGCGGTGCGAATCGAGAACGAAAGCAATGTGACGTATGGTCG
ACACTTTGATCACAAACATCGATTGTTTTCGCGGCTGACGCGGCAAAGTATCGACGCGCTAAAGGAAAACTTCCGTGATGATCTAGCCAAAGAAGACTGG
CAATTGGTCATAAAGCTGAAAAAAGTGTTTGATATCATTTAGA