Description :
From Genome Similarity Track
Location :
Scaffold_3:431627- 435413
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01303N-acetyltransferase
Phypa_INRA-310PPTG_01304hypothetical protein
Phypa_INRA-310PPTG_01305hypothetical protein

Sequence
3786 bases(100 bases per row)
GTTTGTCCTTGGTGACCAACTCCATTTCAACCTGGTTGAAAGCAGCGACGTAGTTGTACTTCTCATACCCCAGCCTGCAGTCGCACAACCGAGTTAAAAC
TAGCCGTTGGTGGTGAGCAAAACCATCAGCATATCGTACTTTTCGAAGAGCTGGATTGAAGCATGATTCGTCTCTATGATCTTGCAGATGAACCGGGTCA
CGTTGAGTTTCGACGTGGCTGCGTAACGCAAGTATCATTAGTCACAACCAGCCCATGACATTGCAGCAATATCCTCCATACCATAGGCCATCATAAGCTT
CACCGCCTCCATCGCGAAACCCTTCCGACGATATTTCTCCTCTGCAATCATGATCTCCATCTCGCACGCGTGGGGGTCGTCATAGTCATTGAAGAACAAG
TTCACGTCCCCAGCCATGCCTACATTCAACGTAAGCTACGTCAGGAATTCGTACTCCATCTCATCACCAGTTATCTCAAACTCACGGTCAATCGCGTTCT
CGTCGACGTACGAAGTTCCAGAATTGCCATCGCTCTCATCTCTCGCCAACACGATAAAAGTGCACTCTAAAACACGATCAAATTTCTTGTCACTCTCCAG
TTCAAACGCTTTTTTTTTTACTTGCAGCTCGTACTCTCGGCGTCATCTCTCCACGACTTCTGCATCTCGAATTCCTCCTCGATAGACAGCGGCTCAGACG
CTGTCATCTCTGCAACAAACATGCAGTAAACAAATATTGAAATGAATAAATAACCTCCAGAGAATTTGTGCATTATGGTGCTTGCCTTGTAGCCATGGGT
CTTTCATCCAATTGTGATACTTTGGCACATGCTCCATCTCGTATGGAACAAGCGTCACCTGCTGCCCGGTCTACAGATACAGAATAATATACTGCTTGAG
TAACAATATCAGTGTGTTTAACTATAGTGTCTGTGAACGTACGATAACGACGCCTTCATTCGCCTTCATAGTGACCGCAAAAACAAAATAATGTAGTGTA
TCGTACATCATATTATCAATCTGATCGCAATCAATTGCGCAAATTCAATATGAGTCCATCGGCGGATGCCGATCTCGACGCGAGGTTTGGAGAGGTCCTG
CCCATTCTTATCCGTAATCGATGGGTCCACGTAATGCGCAACGCTGTTCTCGTTAGGACGAGGCGTAATTTGCACTGTATTGACTTCGTCATACGTTGAC
ATTGCAGATTGATACTTTGGAGGTCATTGCGACGGTCAACAAAACTCTGCGGTCGCTCGTGGAACAGAAGAAGCTGCGACGACTGGCAGTTCGAGCCAAC
GGATTCCCTGTTGCCTCCAGATTCTGGTGTGTATTGGAATATTTACTAGATAATTGTTATTGTACCTAACATGTTGACTATGTTGTTAAAGCCATTGGCT
GCGAGCTGGGGACGTGTCGACGCTGATGAAGGAGGTCCCAGACGGAGCAAGCAGGCGAGATTTCTACCTCAAGGTAAGGCCAAAAGTTGGCGATATGTTG
TACTAGTAAAATGAGGAACTGATCGAGTGGGTTAAAGCTGGCGGGGATTGAGAGTCTGGAGGGCAAGGCGACGCTGGAGACCACGGGCGTGGAAGGAGAA
ATCGACCGAGATATCGAGCGAACTTTCCCTGCGAATCCCTTATTTTCTGAGGAAGGTGAGATTTGATAACAGGAGGGAAGAAAATTGTGTTGGTATTTTA
ATCATATTGTGTCGATATTTTAGGTGATGGTAGACGTCTGCTTGGGAATGTTCTGAAGGCGGTCGCGCATTATGCAGATGACGTTGGCTATTGCCAGGTA
TGTTGGACGCTTGATGATATTTTTCGAGTGCTAGAACTGATGCGATTGTCTTTGAAGGGGATGAATTATGTTGTTGCTGCGCTGCTAATCGCCATGAAAG
ACGCTCAAGATATTTCAGATTTGGATCTCCACGGCCTCTCGATGCAAGAAGCAGCGTTCTGGCTAACACTTGCCTTGATCCGACGCAAAGGAATGGCCGA
GCTGTGGAAACACAAGATGCCAGGGTACGTCCACCCTTGGTCTTTAGTGGAGATTTCTTACTGATACGGAAGACCACGATGATGTACAGGCTATCGCAAT
GCATCTACCTATTCCAGCAACTTCTCAAGCTTCACTTTTACGACCTATCAGCCCATTTCCGACAGATCGGGATGCATTCCAGTATCTTAATCACACAGGT
AATGAATCCATCCCCAAAGCGAGTCTATCGTGTCTATCTGAGTGATTTAACACGGCTGCTTTGTAGTGGTTTGTGACGATATTTGCTCGTGTGCTTACTA
TCCCAACGCTTATCCGAGTGTGGGATCTCGTCTACCTGGATGGTTGGAAAGCTGTTTATCGAGTCGCCCTCGCCATCACCGCCGAGTTGCGGCCAAAGCT
TCTCGCCATGGTAACAAAATGCATTGAAGCTAAAGAGTTGCCTTATACTGACCCCAATTGCTGTGTAGGATCTCGAAGGGTGCAGCGAGTTTTTCCGAAA
GAACCCCAAGCTGGGTCTGGAAGAAGTACTCAGCACTGATGTGTTGCTACAGCGTGCACTAAGCTACAAAGTGACTCGTTCCAGTCTTCAACAGCTAGAG
GAAGAGCGGCATCTCGAGGTAGAGACCCCCTTCATCATCTTTACAAACTACCAGCTAATTCTTTGCTTGAATCTCTCCAGTATCTTCGTCTTCGCTTGCA
GCAAACGCCGCTATCGGAAGAGCATCGCATGTTGTTCCCTACACTCGAACACGAGGACATCGCAGCCAAGAAAAAGTCTCTCGAATTAATCCGGTCCAAG
CTCCAACGGTTCGACACGGATGTAGCAAGTGACACGGTGTTCCTTCAACATAAAATCGAGTTAGCGGAGAAAGCACAAGCCACTGCCATGTCCGTGCGCT
ACGCCATCGCGTACGAGTTGTCGGAAGCTGCGATCGAGTTGAACGAGCGCATGGAGATCAAGAACCGATTGCGCGCAAAGTTCCGCAAGCTCATGGCAAC
GGCGATCACCGAAGCCTCCACCTCGTCAAGCACTTCTTCGTCAGGTTTTACGCTCTGGATGAACCCGTTCGAGTTCCTAAATGAGCGTATGGCCAGTTGT
TTCGAGCGTCTGCCGCTGTTTGCAAGCTATCTGGACACCGGAGACGAGCTGTATGGGGGTGACAACGACACAGATGACGAAGAAGTCGAAGAAACTCAAC
GCAACTTGAAACATCTCGAGATGCTGGTGCCTCAGTTGGCAGCAGAACTGCGTTTGTTGCAGCGTTCAGTAGCCTACAACGATCGCTTCCTTCGGCCTCT
TCTGCAACGAACCAGAAGACTCCAACGTGACGCTCAACTGGCGCGTGTTGAGGTGGAGGAAACGCAGTTGTTCAAGGACCGACTGGCCGACCAATTGCTG
CAGATAATGCTGACCAGCGAGAAGCTCAAGAACGAGCGAATGCAGCAGCTCTTTGCGGAGGTCGATAACAGTACGTGATGAAACGTTGGAAGTATCTACT
GTATTACTACCTGAGTTGGAAGCAGACACGCAAGTGACGCCTCGAGTGCTTCCTTGGCGAACAAGTCAGCGTCGCTCTTGTTTTCTACGTGTTTGGATCC
GTTCTGTTCTGTCCAGATGAGCTCAAGACCTTGAGGCTTTTACTCGCTCTCCGTCACGACGTCGGCCTCAGCGAACTCAGCGGCGACAGCAGACTCAGCG
ACAGCGGGAGCCATACCCGGACCCCACGACGGGAGCTCAGCAGCGACACCACCGAGCGACGGGAAGGCGTCCTTGTCACTGGCGTT