Description :
From Genome Similarity Track
Location :
Scaffold_37:431560- 433096
Transcript NameFunction/comments
Hyaar_Emoy2805327Glucose inhibited division protein
Hyaar_Emoy2805328glucose inhibited division protein A

Sequence
1536 bases(100 bases per row)
CGATGTGATCGTCGTTGGCGGTGGTCATGCAGGCTGTGAAGCAGCAGCTGCTGCTTCTAGAACTGGTAAAAAGCTTTGTTATCTTGTAACCGTTTTAAAT
GTAACTTTATTGAGATAATTTGTTGTGTAAGTAGGGGCTAAAACAGCGCTGGTGACTCAAAAGTTAGCAACAATTGGCGAAATGTCATGCAACGTACGTT
TGTTGATTACGATGCTTGTAAAATTGGTATACTACTCTTCCAATGCAATTAATTAAGCATAAATCGATACTGTTTAATGCTTGTGCATGTAACTTCAGCC
ATCAATCGGTGGTGTGGGCAAAGGCACGTTGGTGCGGGAGGTAGACGCTCTAGGCGGCCTTATGGGGCAAGTGGCCGACTCGGCGGGCATCCAGTTTCGG
ATGCTGAATTTATCTAAAGGGCCGGCGGTGAGAGGTCCACGAGCTCAAATGGACCGAGATTTATACCAGCATGGAATGCAGGAAGCACTGAAAAAACTAC
CTAATTTATGGATAGTAGAAGAGGCTGTGGACGATCTCATGCTGGAGAAACGAAGTGAAAGTGAGAAAGACATTGGGGACCAAGTGAAGGGGATCGTGAC
ATCTTCTGGTCGTGAGATTTTGGCAACAAAGGTAGTAATTACGACTGGTACTTTTCTTCGTGGTGTGATCTACCAAGGACCAGATATTCGGATCTCAGCA
GGACGACACATGCGCGATTCCGACGGACTTGAACCCCCAGCTGTAGGTCTTGCAAAGACACTCGAACGTTGCAAGTTTCCGCTTGGCCGACTGAAGACTG
GAACCCCACCGAGACTTGACGGACGCACTATTGACTATGCAGGTCTCAAAGTCCAGCCCAGTGATGACTCGCCAAAGCCTTTTTCATTTTTGAATGAGCA
TTCTCCGGTGCCTCTGGCTAGTAAGCAGGTGGTTTGCCACGCTACATATACTAACGAGGAAAGCCATCGTATTGTGCGTGAAAATTTGCACATGCTGCCG
CAGTATGACGGAGGTCGAGATGGTGAAGGTGTGGGGCCGCGGTATTGTCCGTCGATCGATGCCAAGGTTGTTCGCTTTGCTGACCGCTCGAGGCATCAGC
TTTGGCTTGAACCCGAGGGATTAAACTCCCAGATTGTGTACCCGAATGGTATTAGTACCGCGCTGCCTAAGGAATTGCAACTCAAGTTGCTTCGCACGAT
CAAGGGCCTCGAAAAAGTGGAGCTTGTGCGCGCTGGATACTCCGTCGAGTACGATTACGTGGACCCACGATCGTTGCGACCGACACTGGAGACGAAGATG
CTGCCAGGATTGTATTTAGCTGGTCAGATTAACGGCACCACCGGATACGAAGAAGCCGCGGCGCAAGGCATTGTGGCTGGTATGAACGCTGGACTAAGTG
CTAGGGGACTAAAGCCGCTCGTTCTCGACCGTGCCGACGCGTTCACCGGAGTGCTCATCGATGATCTCATCTCGCTTGGCACCACGGAACCGTACCGAAT
GTTTACATCGCGGTCAGAGTATCGTCTGCTTCTTCG