Description :
From Genome Similarity Track
Location :
Scaffold_64:4315- 5760
Transcript NameFunction/comments
Phymu_g3180phospholipase D, Pi-sPLD-like-6

Sequence
1445 bases(100 bases per row)
CAGCCCATTCTGGAAGCCGAGAGATGGTTTCTAACGGATCAAGAACTTACTGAGTCTCGAGGTGGCGTTCCAAGGACCGGCATGGCGACATACACCACCG
GCAACAAAGTGACGTCGTACACAGTCTCAAACGAATATTTCAACGCCGTGTACAGAGATCTCAGCAAGACgaaagaaggagatcgcgtCCTGTTGAACGC
CTGGACGACAGCTCTTATTCCGTTTAAGCCTGACGTCGACCCCACGGGAGCCAAGACTGGGTTTAAGGAAGTCTTCAGCGGTGTAGTGGAGCGAGGAGGA
AACGTGAACATCCTGGGTTGGTCCAACATTGCCGGTGGGTACATGCCGTACAACATCAAAGCTCGAGACGCCATCAACAGCATTCCCCCCTCTCCAATCA
ACGGAGCGAAGGCGATCTACATTTTTGACGATCGCGTTAAACTCATCTCCTCTCAGCACCAGAAGAATATGATCATTACCACGTCAGACCCGAGGGACCA
ACCTGTCGCTTATGTTGGCGGAATCGACCTTGCCAACGACCGATGGGACACCATTTACCACAATAACTCGGCCATCCGCGACGCAGGACACATAACGTAC
CAGCAGAAGGGCTGGGTGGATGGCCACATCCGTATCCATGGTCCAGCTGCAAAGGATGTCGCGGTAAACTTCATCGATCGGTGGAACTCGAAATTCTTGC
CATGTCAAAACCTGAAACAGCGCTTGCTTGACTTTGCGAACCCGGAATATGACGATATCCCGCCACTCAATTACTCTAGCAGCAATTCGACAGCTACTCT
TGGCAACCAGAGTGTTCAGATCACGCGAACTTTCAGCTGCAAGTATAAACACTACACGGAGTTTGCCCCTAAGGGCGAAAACTCGTTATTTCAAGCGAGA
ATCAAGGCCATCAAGAACGCGAGGAACTTCATCTACATCGAAGACCAATATTTCGTACTGATGCCGGAGCTATTGGACGCACTCATGGAGGTAATGCCAC
GGATTCAGCGCGTCATTGTCGTCACGAAAGAGCAGACGAACGCATTCACGAACGCTGGCTACATCAAGTATTTGTATCAAAACGTCCACCCTCTTCGATC
AAAGTACCCCAAGAAATTCGCCATCTACACGACCAAAGCTGAGCTAGACCTCTGCATCCACAGCAAATTCGTCATCATTGACGACGTGTATTTGTCCATT
GGCTCGGCTAACTGGAACCGCCGGAGTATGACGGCCGATACAGAGCTAAATGCCGACGTCGTGGATGGAGACACGGTTGTTTCTCCAGAGGGAGTGACTG
TGGGCAAGTTGCCGCGCGACTTCCGTATTCGCAAGTTCGTGGAGATGACGGGCTTGAGCTACGACGAATTAGACGCCATGACGTTTGTGGAGGCTGCAGA
CCGTTTTGCAGTTGCCGCAGCGGACAAGACGACGATACTGGCCCC