Description :
From Genome Similarity Track
Location :
Scaffold_251:43143- 64742
Transcript NameFunction/comments
Phyin_T30-4PITG_20992Polysaccharide lyase%2C putative

Sequence
21599 bases(100 bases per row)
CTTTAACATAGCTCTCAGTTCCTTCAAGCGTTCCTTGTCGTGGCCAACCTTTTTAGCTTCTTCAGCGAGACCTCGTTCAATACCAGCTAACGGAAGCCAG
TGGAGACGCTCCCACAACGCGAACCCGAGGTCACCTTGCTTACCGCCGTCACCCCGAAGGTTCGCCCAGATCATTTTGAGACGGGTCTCAATCGGGGCAC
GCTTGGAGATGGGGACGCTTGGTTTGAAGTCGACAGTGTCAAAGAGGCAAGCTTGAAGAGGATAAAGCTGCCGAAGTTGCTGGTACGGGTGATCAGGATG
CGAATAATCAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGTTAAGCTCAAGAGTCGCTCGAAACAC
TTCTTGGCGCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCATAGGGCGAATACCAGATAACA
CTCGGTGAGGCAACGGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAAGTGTAGGTTGCCGTAATCATGCGTCCAGGTCCAGCATCGAGAGTCCA
AATAGACGGACGAGGAGACACTGGAACAGGAAGAGAAGATGCTGGTGCCGGAGGACTTGCTGGTGGCGAAGGAGGCGGGCCGCCAACGATGATTGGGGAA
GTCATCATCGGCGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGCCAAGATTACTCCAGTTCCTGTTTGAATCTTCAACATCTTCGTCATCGA
GTATGCTTGAATGATCGGTGGGGGGCGGAACATCACCGCTACCACTGGGAACATCAGGAGAGTCATCCACCGAAGATTCATTGTCATCCACGTCATCTCC
ATAGTCGTCATCAGCATTCCCATCGTCATCAATCTCCATCGAAAGGCCAGGCGAAGACACGCTTGGTACATCAGTCGTGGGAACAGTCGGAGCCGACTTC
GAAGACGCGGAAGCTAGTGGAGCAGCCTCAACAGGGGCATACCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGCCTTGGATGTCGCGGCAGACGCCG
AAGCAGACTTGCCTTGTGGGACAGTCTGGTTTGACTCTTCATCTTCGTCACTCGAGCCAAACATGAGCCGCATTTCCTCGGCCTCGCGCAGGGCCTCTTC
AGCAGCACGTATGTCGGCTGGAGAAGGTGAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAG
ACAGGAACATCGTCGTGATCCTCAGGGTTCACGTCCTTACCAGAAGGCTGTGTAGCAGTTTCTTGAACCGAAGGGACGCTGCCTGGATCAGCAGTCCCCA
TGTCCACGTCACTCTGGTCGCCGCTGAGGTCGACCACTGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTAC
AGACCTGGACCGAGTCTTCATATGACGTCGTGGTGACTTAGCAGGAGAATGAGGACGAGGCTTCTTGCGCTTCTTCTGGGCCGCCTTCTTCCACGCCTTC
GGACCGAACAGCGATCTACGAGCCGACTTGGGAGTTGAAGTATCGGCAGGTGGCGCATCACCGAGACCGGCAGCTGCCATCGAAGCACTGGCCTTGTCCG
TTGGGATTGGAGCCTTGTCTTCGTTAGAGTCGTCCGGATCGTCGTCTGAATCCCCGCCACCTGGTCTAAGACGCTTATGGGACTTCCCATGGGCCACTTG
GTGACGGAAGGGCTTGAGGATTGTCCGAAGACGCGGTGGCAGACTGAATACGCCGCAGAGCGACTAACGTCTCCTGATCCAAGTCCAGCGCATCCAGGTC
CAGCTCACCCGCAGTCAGACCTATCACGAAGGATTGTGAACGAACGTTAGTTGCTGAACACACGGTGGAAGGAGCGACATTAAGAGCGTACCCTCGACAG
CCAGACGAAGTACCTCGGGATCCATCCCTGCCAGACTCACGTGTGCACGGAGGGTACGATTCGCTTGGAGGAGGCGAGTGTTACGGTCTTGCTGGTTCTC
GAGGACCTGGAGCGTGTCGTTATCGACATACTTGCCCTGGGCAAGCTTTACCAGAAGGAGGTGGAGCTTCCGGGTCTGCTCAGTATTCGCGCCAATAAAA
GACTTGTACACTTCGCGTTCGCGAGCCAGCTTCTTCTGCAACGTGCTGATAAAAACGTCCCGAGCTTGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCGTGTCGGTATAGCGCAACCTAGC
AGCTCCTCGCCACATCAGACAATGGAGACTGGCGACAGTAAAACAGCGTACTTTTACAACGGCAAATTTCATTTACTGCCCGAGTCGTTTGAATTCCCTC
GTGGAGGACCTTACGCTGCCTGGATGCTCTGGTGGTTTGGCGATAAAGCACGAAATTATCCACCCCTCCGAAAAATTCGCCCTCACGACTTACCGAAGAG
CAGTATGTGCAAGCGTTTCTCAGATTGGACTAGATTAATCCGACATATTTGCACAGCCATTACGACTGCAGGAAAAACTATCCCGAATGATATGACCGAG
CACCAAGCTTCAGACCTCTTTCGTGTGGGCATCAGTAATTTAGAGATGACCCCTTCAACCAGAAAGCGACGACTGGAGGAGCTTTCGCTAGCTACTATCC
TACGACTTGTCAGAGAGCAGGCAAAGAGACTAAAAACAAATTAGCCAATCAGAACAGCTCATAATAAGTAGGATTGCATTCCAACGAATTATACAGATAA
GTGAATATATCTTGTTCGATGGTCGCCTCGATAAGAGTATCTTATCTTCTACAGTACTGCACATGCACCACGTACATTACATTAGTGCATTGGCTATAGC
CACGAGCGCTCCGCACCGGACGCCGTTAGAAGTGTACGAACTCTTCTTAACGCTGACCGTCCAGGCAAGCAGCCCCAACACAAGCGCTTGATGGCAGATC
AATCGCTGAGCGTCGTTTTTGAGACGCAAACTCAGAGCTGCAACCCCTCTCCTTCCATTCCCCACGGCTGGTTGACATCTGCAAGCGCAGCCCAAAGCCC
ACATCCTTGATGTACTCTGTCTAATCGGGTTGCTGGCCGTCTTGGTCCCTCTATCGATGATTATGCAGGCTGTACAAGCTGAGAGGTCACTGTGTGCACC
CACACTCTCCTGTTCTGGCGCCCATACGCAGCTTTCACGCCCCCCTTACATCTTTGTGTGTATCCCATTCCGCAGCGCGCCCGTAGTTCGTATTGCTGGA
TGTGTCACTCGCGTTCTTGCCAGTTTGCACAACACTAAATCTATATTGCTCTAAAACCTAATTTTGTAAATTATTTCTCAAATTCAGATGTTACTTCGGT
TACTTCACTCCGTTTTGGTTTACACTGACACCAGTTTGGATTGGCAAAGGTGTACTTGTTTGCCTTCCTGCCTTTCGCTTCGGCGGGATAATTATCTCAA
AACCTCCGAGCCCCTGTGTGCCTAAATCAACTTCTTTAATTTCATAAATCTGGGTTTAATTTAGACCAGTCGCTACAAAATGCCGAGTTCCCAGTAAGCC
GTGCAATTCTTTTTACAAGAGACTGAGTCCCTAGCATCATACTTACCATGCTTAGAAAGGTTATTCTAGTGATCTATACACAGTCTCTTTATTATTGTTG
GCTATCACTGTACCTTCAACTTCCACCCAGACTTTAAAAAGCATGTCTACAAACGCTACACAATATATTTAGTTTAGCGATTTCATGGGCCGTTTCTGAG
CCGCTATGAGACTTACTTCTAGCTTTGCATCAATGCAAAGGATAGTAATGGCCTGTACAGCTGGCACTAAATACCCGCGTGTACTGCCTGTTAGAGCTTG
TAATTAACCGAAGATTGATCACTTCTACATATGGTACCAAACTCAATGAAAGCTAAGAAAAATTAACAAAATATAGCACATTTTAACCCCTAGTTCCCAC
ATGTTGTAAGTTCCAACATAAGAGGTGTGTACCCTGTTGCAGTGTCTTTGTTTATACTGGGATAGCAGTATGAATGGGTGCTGCTGCACAGCTCAAATCA
TGTTAATTCGCGTCAGTAACTGAAGCCGGTAACTGAAGCCGGCGGTTAGGGATACTCTTTACGTATTTGCGGGATTGCCACCGGGGCGGTCGTGGCTGCA
AATCATGTTGATTCGCGTCAGTAACTGAAGCCGATAGCTGAAGCCGGCGGTTAGGGATACTCTTTACGTATTTGCGGGATTGCGACCGGGGCAGCCATGA
CAAGGCAGCGTATCAGCAACGTGTCGACCCTTGCGCCGTACTGAGCTACGAGAGGTTCTGCCAGGAGGTCGAGCTGCTGCAGAGGAGGTCGCACGAAGTG
GCGAGCGATCAGGACGCGGGGGATACGAAGCCGGTGGCGACTTGGGAGTGGAGACACGGCAACCGACAGGTAACATGCGCCGTTAAAATCCTCTTAGTGC
TGGAGTTGGCATAGGATTGATCTTTGATGCGATGTTGAAGCACTTGGATGGAGACTCGTACCTGTCTCAACGGGAAATGTGCGGCAATTAGGACGCGATG
AAGATGAAAAGAGTGGGAAGGAGCTGACTGGGGACATTGACGAATTGCTGTTGGATGAAGAGGTGGGCTAGACATTCTACCTTCACCACGGGAAAGATAC
TAGATGTTTACAGTTGTGACTCACATCGTATCTTGCTATACTGCTTAGGGTATCATGACGGCTGATGACGAAGCTCATACTACGTTGCAGTCTCCAGACG
TTGAGACTGCTCTACTTGAGTTCCATATCGTCTACCACACAATCTACCAGACCCCATGTGCTGTACTTCCGAGCAGTATGAGTCGACGGAAGGCCACTGC
CGCTCTACCTAATCACCCAGGACGTTGAATTCCCTGGATCCAATGGCGGTACGTCACTGAAGTGATGTTGACGTACGACAACGCAGCACTGAAGCCTATG
AATGTGAAGGGCAACAAGACCGCCAGAGGTATCGGCAAGAGCGGCGTCAATATGGGTAAGGGACTGACGTTGAACGGCGACAATATTATCCTGTAGAATA
TCCACATCACTGAGCGCAACCGACACGTCGTGTGGGGCGGCGATGCGAGGCTCCAACAACGCCAACACGATTATCAACATTATTTGGATCGACCACGTCA
AGGTTTCTCATGTGGGTCGTCAAATGCTCGTGTCCCGAACAAGGCTGGTGTCGCCACTATGACTGTCAGTAACTCGGACTTTGACGGAAACACCGACTAC
TCGTCCACGTGCGACGGCCACCACTACTGGACCTTTCTGTTCTACGGCCGAAACACCGGCGTCAGCATGTTTAACAACTACGTGCATGGAACTTCCGGTC
GGTCTCCTAAACTAGGTGGCAACAAGAACGAACACATCGTCGCTAACAACTACTGAGTCGTCTCTCAAAGGCTGGTAAGTACGTTATCTACAGCAACCTT
TGGAACAAGAATGCCGCCACCTCCGGCAGTCAATGCACAGGCGTCGACAGTGTGGATCCAATGGCGGATCCCCGTGCACTTGAGCTGCAGCAATGGTACG
CCTGTTTGCCTCCCGATCATTCTTTTTCTCGTCTTGGCGTACACTGAGAACTAGCGTACCCTGGGCGGGTTTCAGTTCATTGCTGCTCTTTACTACATTT
TAGGCGGTTAACTCAAAATACACCCTGCGTTTGCTATCCCAGCCAAGCGTAGCCCTAGTGTTGGAACACTCAACATAAATGATTTTTTTACTTGAAGTTT
GTATTGCACATCTGTCATTCATCCTCGTTTAATGAAATTGTAAATACGAATGTCGCTCCTTGTGTTTGCCTCCGTTCCGCTCGCCACGGGCTCGCTTCAC
TACTCGCACGGTAGGTTGGCAGATTGTGGCTCAGGCGGGCCCAAAGGCCCGCAGGGTTGCAGAAGGTGCCGATTTGGGCGCCCGGCAGCTTTTAGGCCAA
TGGGGGCCACCTTCGCTGCGCTCGGCAGCCAGTAGAAATATTTAAATAATTTTATCCAATGGTTTGTCCGGAAAAGCGTGACAGGCACGACAATTTAGTG
TGACGGACAGACAGGTTGCTGCAATAGATGTTTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGCTTTGTTGGAGATGAGGTGGCCGCAA
ATTTAAGTGCCTCTTGGTGTCGCGTACTTTGTGAGCGTCGTTCACCCCAGTAGGTCTTGGCTTCATGTACTTAACCACTTAACATTCCGTAGTCTCATGT
GGACCCGTATAATATCGTGGTTTGGTACGCTTCCGTTACCCCGTACTACAGGTTGGATGTCATGTTCTTCAGTGACCGGCGCTCTTCCGTGATCTTCCTG
GCTTCGTGGCTCCCTGCTCACCCGTGGTCCATGCTGCTTAGGGCCTATGCGCCCTCTCTTTTGGGTTCATGTTCTTCAGTACGGTCTCTTTCTACCTATT
CCCGGTATTTACCGCTTACGTGGGCTGCACCGGTTTCGTTATACATGGTATTTCGTGGTCGTTGGCCTCCCATCGCTGGTACTCTAGCCGAAGGGTGCTA
TTCCGTGGTTTGGTGTCTTCACGCAGTCGTGTTGTTCCACCGCCCGTGTATCGTGCTCTCCTGGCGAGGTTCCATCGACTACGTTATCACGCTATCGTGC
AACTCCGGTGTGGTAATGCTGTCTAAGGTATTGTGCTCGCGCAGTGCATCTGCGTTTTCCGTATATTATCGTGCTCTACAATGGCTTCGTGCTCCGTGGT
GTGCAATCGTGGTCACCCCAAGCACCCCCCGTGTAATTTGTGGCTGGGACACCGTCCGTGCGATCGTGTTCTAATGAAGTACTGCCCTCCGTGGCTCGGT
AAGCTCAGGTCCAACACTGGTATCTGTGGTGTTGGAAATCCCACGTGAGCTCTAGCTACAAATGTAGTTAGGATGATCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTAAGAGAAAGGATGTGCT
TACGTACCTTTCAAGCTGTTTCACGCTCCGCGACGTCTTACGAGGGATTGAGGCCGCTGGAATCGCCGTGGACACGACTCGAATCCAGACGCTTGGACAT
ACGGTGGGCGAGATGGGTGAAATGAAAGATGGAAGAATGGTCACAAACGGGCACCAGTACCGTGGCTTTCCATTGCGACAGGGGGCAGTTGTGGTGTAGT
GATTTTCTCCCGTGGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGGCGAACCCTCGGTCGGGTGATGTACGGAGAC
GCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAGTTTTCAAAAAATATCGGATACGGCCCTATGTCACTGAATCCAGGCTGTCCTTATTATTAATAA
TGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTGGCGGTTGGGATGAGTTCGCGGAATACTCAGCGACCTTTGGAAGACAC
GTTAACCGTCTGGGACAGGGCGCGGACTGTTAAAGATGCTCATGCGACAGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGATCATTGTTCAC
TTGATATTTGTATACTTGATTATGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGAC
GTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAA
GAGACTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTA
TTTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTCAAAACACCTG
CTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTAACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGG
GTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGGAACATCCTAACTACATCTGTAGCTAGAGTTCACGTGGGATTTCC
AACACCACACTTTGCTCCACTGCATTGCCTGAAGTTGATCAATCTTGTACGCCTTCTTGTCATTGTTTTCTCCTCGCTTTATTCTGTCGTACACCCACAG
AAGTTGTTTCCCACTGTACGCAGACTTAAACGCCGCAATGATCCCAGTGTCCGTAGGCTGTAGGAAAGCAGTGACAGGTGTGGAATGACTCTCGCCAAGC
ATTCACATCTTCCCTCCCTCAATCGATACATGTATTAGCATTTAAGTCCGGATATAAGTTTTCAGTAGTACCGGAATCGCCAGCATTTACTGTATACGCT
ATACGTTCGACGGATGTGAAAAAACAAATCAGCACATCGGAGAGGAGTAAGAGATCAGCTAGGTGTAGGTTTGAAGACAGTCCCCATTCGGGCACTTCCT
TTCCAGAAACGATATGAAGAAGCGCGGGGAAGACATGGAGAACATAAGCGCGCGCGACAGATCGACCATAGACAGCCTCGGTAGGCGCTACCGCCCGCAA
GGGATGTGAGATGCCAGCCCATGTGTGAAGAGGCTAGCACCAGCAGTACATACAAGTGGACTGTCAGTGCCTGGTATTGACACTGACAGCCGATCCTACA
TCCTATCCTACGCCTGTTGCTGCAGCCTGCGGCTGCGCACTTACCGACGTGCCACGTGCGGTTATACCAAGTTTACTATGATTGATGGACAAGAGCGACC
GTGCCGCCGTGCTGCTCACGACGACACTGACTTAGGTAAAGTATGGCTTATATGAGTTTATGTATCGAATAGAACCTGCGGAGAGGCGTACTGGCTTGCG
TGAGGCTTGCTCTCTCTCTCACAACTCAATTTGCGGTTCAGCGAACCTCAGAGAGAAGAGCAAGCCCACACCAGTACTGCAACCCTGTCGTGGCCTTTTG
CCCGGCACCCACTGTGTTTACGTACCTCTTTTGATTGCTTTACTACTTAAGTGTAAGTCTACTCTAATGGCACCTACGCTTAGAAGTGACCTACGCTTAG
AGAGCAGTCCAGTGACGCGCCCTGCGTCACCTCAGGTTATGAGCCCAATTAGGGTCCATGGCTCGACAACGGACGCACCTGGTGTGGAAGATCAAAACGC
TGGCGGAGTTTTGGCGAATGGGAGTCGAGGAGTGCGCCGATTGGCTGATAATGTGGCTGATGTAGCTACTGGACGTGACGATGATGTTCTGTCACACGAA
GAAGCCGAACACCTTATCCGAAATTCAAGGTGGTCGATCATTGGTAGAAAATCTCCTTGAAAGATTGCGAACTCGCAACTTTTCCAGGCTGATTAGAAAT
CAGCCACCACCGCCACAAAGCAATCCAAGTGACGGCATTGACCCCAGCACAGGGCACAGCGAAGCCCAGAGCAGCCTACCAAGCATGCTGGACAACCAGA
ACCCCGGCGGGCGCTACGACGACGCAGAGCTCGCAGAGCACACGAAGTCGCTGCGCAACACGGCCGACTTTCGGCTGCCCCCGTTATCAAAGAAGGAAGA
ATACACGGCGTGGGTTAGTGAGGTGCCGTTGCACTTTGAGAGCCGCCTGCTGGGTGAGATTACCTATGGTGCCGAGAGATTTGACTCCGTGGAGGGCTAC
AAGAGGCCTAAGTATGCTGAGTGGTACAAGGCAAGGAAGGTGAAGGCTTTCTCAGCCCTAGCATTGTCACTCTCGGTGGATCTACGAACAGCATTCAAGA
TCAACTCCATACGTGATCAGATGGAAGGCCCGTTACTACTTTGGCAACGAATTACTGAGCATTTTGAGGCGGGTGACGGCGTTAACCCTGATTACCCGGC
GCGAGCTGATGAACCGTCAGCTGCAGCCCAAGGAAGCTGTGACTAAGTATGTGCAAGACATTGATGCTATGGTACGCCGACTGCGACTAGCGAAGGGCGA
GTTTGAAGAGTGGGAACATGCAAGTCTACTTATCTCGAACACGCTGTTGATGTTTCCTGAGCTGACACGAGAGCACTCACTCTGGATGAGCAAGCATGAT
CGTCGGACCATGACACTTGCTGAAGCGCTACAGCGCCTGCGCACTGCGGAACACTCAAGCAACCAGTTGCAACAGCAGATGTCACTAGCGGCGCCAAGGA
CAGCGCAGTCAAACACGAACCAAGTGAATAATGTGAGTCAACATGCAAGACAAGGACATGCAGGCAAGCGTCAGAGGCAGCGCAAGGGCAAGAATGCTGA
GAAGAAACTGCGCTATACCTGTGCTAACTGTGACCAGCATGGCCATTGGGATGCAGAATGTACTGCAAACACTGGCATGGAACTGAAGCCTGCGTTGGTA
CAACGACTGAAGAAGAAGAAGGCCAAGAAGCAGACAGTCTCACTGATTAACTCCGTGCGCCGCGTGCATACGACGCCAACGACTGGTGAACCGCGTCGTC
TGTTTGAGAACTTGGCGCTGAGATCGCCGCACCCAAGTAAAGGTACGACTGGTGCAAGCCGTGAGAAACGCTCGGTATCGCCTTTCTACTCTCCGCCATC
ATGTGCAAGCGATGACGATGAGACGGAAGAACGCAAATTCGAACCAGCGGATGATGTGAGTGTACCGATGACACCGCAGCAATTGCAGCTTCAACCCAGT
CAAAGCAAGCAACTTACCCAAGTTGAGCAACCCACTCAGGCTGTGCAAGGTAATCAACCCAGTCAAAGTACCCGATCTGCTCAAGCCATGCAAACTGTGC
AAAGTACTCAACCCAGCCAGAATATGCAACCTGTTCAGACAATGCAAGCCATGCAGCCTATGCAACTACTGCAACCTATGGCGAGTACTCAGCATGAGGT
CGGAACATCGTATGGATGGCAGATACCGACTATGGATGCTGCGCAGGACCAATGGGGGGGGACATTTTCGAAGGCCACTTCCGACGTGGGATGCACTGTT
CTACTCCTTAGGCCAGGGATTCTTGAGTGGATTGCAGAGACCTACGTTTGAGCCAGGCCGTAGAGGTGGACCACAAGTGGGTTCATCTGTGCCAGGGGAT
AACCACCAAGGTCGTTAGGCTGAGCCACAAGGATATCAAGGTTTTGAAGGACGCCTGTACGATGGAGGATCGTATGGTGGACAGAGAGGATCGTATGGAC
CAACTTATGGAGGACTGTTTGACGGTGAGTGGCCTGGATTAAGAGAAGCACGTAGTAATCCACCCGTTGACTATGGGCGTGGCTACACATCTCCCTTTGG
AGGAGGAGACTGGAGATTGCCACCTCGGGAGAATGTTGGACCCCCAAGATCGTCACTACCGTGCTACTCAACGATGAGAGGTCCACCTGGGCCTCGCAAC
CAAGGCCGCTCGCCAGATCGTGGACGCTCACCAGATCGTAGATGCTCGCCAATTCGTGGACGCTCGCCACCTCGCGGAAACTTTAGGCCTTCATGGTCAC
CACCTCGCTGGCGCTCGCCGCCGAGAAGACGTGCAGGACCGCGTCACTCGCTGCCAAGAGGACGATCACCATTGCGTGGCACCCAGAGTCGAGGCATGTC
GTCTCCTCGTGGACAACCAAGACGCGATGGATCAGTGCAACGCAGACGTGGAGGACGCACTCGGTCGCCACGACGGAATCAGACGAGTCACTATGGACCT
CAATCTGAAGAAGGACGCCGAGGAAGTAACAGTACCCAAGGCAATGAGACAGGTCCCAGAGGTGGACCAACTCAGGGTACTGAGACCGGCCAAGGACAAG
ACACTGCAAACCAAGGTCAGACGTTTGCGGTGAATGCAGTTGGACGAGATAAGAACATGCAATCTGTTGAGAGAAACGTTACGGAGTGGATCCTCGCCTC
GGGATCACAGGCCAACATTTGTGGTGATCTATCTCTGTTCACGACACTGCGAGAAGACAAGACGAGCCGACTCGACTTCGCTAATGGTACTACGGAGCAC
ACGACGGTTAATGGCTCTGTCCTACTGCGAGTGATCAACCAAGCGGCTGGTGAACTTGAGGATCGTCTGCTGGATGATGTAGTCTACACGCCAAATGCCA
AGGTCAACCTGATTAGTATGGGATACCTACAGACTACAGGAAACTACAAGCTGATGTGCTCAATGGACCAGAAGACGGCGTGAATGTCGAAACTGGGTAC
TATCCTAAAGTTTGAGATGCGAGACAATCTCTACCGGCTGCGGAGTGAAAAGGCAACCGGTGTGATGGTCATGGCCATGGCTAAGCAAGCTGTAGAGGAC
AAGAAGACGATGGAGCTCCAACATCAGCGCTTTGGCCATCTACGCATGGCTTTGCTTCAGGTGATGGCTGATAAGATGGACTTGGGGGTAAAGCTCAACA
CGAAAGATCTGAACACCTACGAATGCATTGCCTGTGTTGTGAGCAAGACAAAATCCATGTGTCACAAACGACTTTCAGTCCGCTCGACTAAACCACTTGA
AACGCTGGCTATGGACATATGTACGATGAATGTGGAGACAGCAAGTAAAGCTATTATGTTCATGTTCATTGTGGATGTTGCTACGAGATACAAGTGGGCC
TATCTACTTGAGAAGAAGAGTCAAGCTACCTGGTTCATCTTGAAGCTGCTAAAGGAGTTGCGGACGCATAACAAAGACTGCAGAGTCTTGCATCTTCGGT
CGGACCAAGGTGGTGAATTCGCTGGAACGGAACTGCACGAGTACTGCGTTGAACACGGCATCGTGCAGCAGTCACGAAGAATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACGCTGAGATTGAAG
CCTTACACCACAACATCAAGATTCTCCGCGAGTCGAACGCCAAGAATGACGCCATGCTCGCAAGTGTTCAAGCCACTATGGAGCGACACGCAGAGGATTT
GAATCGTCTTCACTGCAAAGTCCAAGCTCGGGACGTTTTCATCAGCACTTTGCAAAAGAAGCTGGCTCGTGAACGCGAGGTGTACATGTCTTCTATTGGA
GCGAATACCGAGCAGACTCGGAAGCTCCACCTCCTTCTGGTAAAGCTTGCCCAGGGCAAGTACGTTGATAACGACACGCGCAAGGTCCTCGAGAGCCAGC
AAGACCGTAGCACTCGCCTCCTCCAAGCGAATCGTACCCTCCGGGCACACGTGAGTCTGGCAGGGATGGATTCCGAGGTACTTCGTCTGGCTGTTGAAGG
TGCGCTCTTAATGTCGCTCCTTCCACCGTGTGTTCAACAACTAACGTTCGTTCACAATCCTTCGCGATAGGTCTGACTGCGGGTGAGCTGGACCTGGACG
CGCTGGACTTGGATCAGGAGACATTAGTCGCTTTGCGGCGCATTCAGTCTACCACCGCGTCGCGTCTTCGGACGATCCTCAAGCCCTTCCTGCAGCTTTG
GCCAAAGCCGCTCACCAAGTGGCCCATGGGAAGTCCCATAAGCGTCTTAGACCAGGTGGCGAGGATTCAGACGACGAGTCGGAAGACTCTGACGAAGACA
AGGCTCCAATCCCAACGGACAAGGCCAGTACTTCGATGGCAGCTGCCGGTCTCGGTGATGCGCCACCTGCCGATACTTCAACTCCCAAGTCGGCTCGTAG
ATCGCTGTTCGGTCCGAAGGCGTGGAAGAAGGCGGCCCAGAAGAAGCGCAAGAAATCTCGTCCTCATTCATCTGCTAAGTCGCCCCGACGTCATATGAAG
ACTCGGTCCAAGTCTGTACCGTCTTCTCCAAGTTCATGGTCGCCACCTCCTACACCAGCGTCTTCCTTGACTCCCGCCGTGGTCGACCTCAGCGGCGACC
AGAGTGACGTGGACATGGGGAATGCTGATCCAAGCAGCGTCCCTTCGGTTCAAGAAACTGCTACAGAGCCTTCGGGTAAGGATGTGAACCCTGGGGATCA
CGACGATGTTCCCGTTTCTCCTGACGCGCCTTCGCCTCCGCCTCAGGGTCCACACGATGTGGCCAAGCCACCAGCTTCAACGATTTCACCTTCTCCAGCC
GACATACGTGCTGCTGAAGAAGCTCTGCGCGAGGCCGAGGAAATGCGGCTCATGTTTGGCTCGAGTGACGAAGGTGAAGAGTCGGACCAAACTGTCCCAC
AAGGCACGTCTGCTTTGGTGTCTGCTCCGACGTCCAAGACAGTTGAAGTCTCGGGAGTGGTTTCTACAGCAGGGCCTGCCCCTGTTGAAGCTGCTCCACC
AGCCTCCGTGTCTTCAAAGCCGGCTCCGATTGTTCCGACGGCTGTCGTACCAAGCGTGTCTTCACCCGACCTTTCGATGGAGATTGATGACGATGGAAAT
GCTGGTGACGATCGTGGAGATGACGTGGATGATAATGAACCTTCGGTGGATGATTCTCCTGATGCTCCCAGTGGTGGCAGTGATGTTCCGCCCCCCACCG
ATCATTCAAGCATACTCGATGACGTAGATATTGAAGATTCCGAGAGGAACTGGAGCAATCTTGGTCCAGCTCGTCCTCCGACTCCACCTCGGCCAAATCC
TTCGCCGATGATGACTTCCCCAATCATCGTTGCCGGTCCGCCTCCTTCGCCACCAGCAAGTCCCCTAGCACCAGCATCTTTTCCTCCTGTTCCAGTGTCT
CCTCGTCCGCCTATTTGGACTCTCGATGATGGACCTGGACGCATGATTACGGCCACCTACACTTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGC
CGTTGCCTCACCGAGTGTTGTCTGGCGGTCGCCCTTCGGTGCCGGCTTCGTCCACCTTGCCACCGTGGGTTCTTCCGTTCGTGGACATGGAGTTTACTGA
CGCAGGCGCCAAGAAGTGTTTCGAGCGACTCTTGAGCTTAACCCTTCCCGAACCGGCTGGTGAGGTGACCGTGCGTACCACGTTGGAGGGTCTCCAAGCG
TTCTTTGATTACTCGCATCCTGATCACCCGTATCAGCAACTTCGGCAGCTCTATCCTCTTCAACACTGTCGACTTCAACCCAAGCGTCCCCATCTCCAAG
CGTGCTCCGATTGAGACCCGTCTCAAGATGATCTGGGCGAGCCTTCGAGGTGACGGCGGTAAGCAAGGTGACCTCGGGTTCGCGTTGTGGGAGCGTCTCC
ACTGGCTTCCGTTGGCTGGTATTGAACGAGGTCTCGCTGAAGAGGCTAAAAAGGTTGGCCATGACAAGGAACGTTTGAAGGAACTGAGAGCTCTGCTGAA
GAAACTCTTCAGCGAGCGCGACCGTTGTGCCGATCGTCTTCGTAACAAGTACCGTGAGCAGTACATGGCGTGGAGTCGAGACTCGGTTTCCTCTAGTGCT
TCCGGCGTGCCGTTCATTCGTCCCGAACTGCTTTTGGAGCCGTCGAAGCCGTGGTACCCCATTGAAAACTTGTCGTTCGCACCTCGGACATCTGACTGGC
TTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCCTGGCGTACTGGATGGATGAATGCACCGCATAAGCACCCGTACAGCACCACGTACTTCCCGTGCCA
GCGTAATCCGGAGTTCTTCAATCCTCGTGGTACGCGTTTCGTGGATGTGTACCGAAGCGTGATCGTTGACCCGTCTCTCGATTCAACCGAACTTATTCCG
ACCTGGCGTTCGTTGTTTGACTCGCCACCGGGTACTCCACGTCCCGCTCTGGCTGCTGCTCCTGTTGAAGCTGGTACCGAGGATTCGCAGGGTGCGGCTT
CAAATCCAGCTGCCGAGGCTCAGGCTTCTGATGAAGAGGAGAAGGAGAGTGGTGACTCGACTTCGTTGGCACTCTTGGCCACCGCGGCCAGGCACTTTGA
ATCGATTTGAATCCTCGCCGCACGTTCCACGACGTTCTCCAGCATCTTAGCTAACAGTTGAGGTGTCCCGCGTGACTTCGTTTTCAGTGGTCGCTCCGCG
GTTGGCATTCATATTTTCTCATTCTTAATTCACTTCCACAGCGTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGTTGCAGTAACGTT
TTTCGTCTGTTACCACAGGCTGCATCGCCCTGTGGACAGTTCACACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTC
TCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTT
TGAATTCGCGTACAGCACGCTCCGTGCGCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGGTCTGGTTCCCA
GCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGCCTAGTACCAACCGAGTGTTCGGTCGACTTTTGAACTCGTTGACA
GCCTTGAGTCCCGACACATGCACTACTGGGTAAAAGCGATATCCACTTCGGTCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCC
GAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCT
CGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGT
CAACTCAGGGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAAGGCGACCTCATGTTGTCGATTGATCT
CACGCCGCCACGCCAGTGCGTCGGACTGCTTGCCGAGTCCTCGTTTGATTGATGACGACATTGCCCGCTACGTCGACTGCGCATCCCAACCATGAACGAG
GTAGAACGGAGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCG
CGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGTCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCAT
CATTTCTGCAAATGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCGTGCCTTATCAGTGATGGGGCTCCGAACCGTCGGTACACACATTCTTCG
AACACTTGGACAACACTCAGTGCAGTCGTATCTGACATAGCCTCGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCTTGTTGCCCC
TGCGAGATTTAGGTAGTGGGATCACAAAGTCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCGGGCGAGTATCCACGAAGCTGCGGACG
GCTGTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACATCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTT
CTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCT
CTTGCCAACCGTGGTCGTACCGACAATTCAATCCAAGATAGTGAAGCACGCCGTCTTTAGATAATACGAACCGTTCAGCATATTTCCAGGCATCTCGAGC
TTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTATAATTTATTAAAAAAATAATATTAAATATATTATTTTTATACCCTTTACGAAGAATTGAACTCGTATCTTTGCCGTGAAAAGGCAAACGAG
ATGAACGTGGACGTGTCAAGCGGTTCAAAGCTCGTCTTGTAATCCACGGAATTCAAGCAACAGTTTGGCATCAACTACGGTGAAACATATGCACCGGTGA
TTCGCTTTGAAACTATTCGTGCGGCCATCTACTTCGCTGTGCAGCGAGGATGGGAGATACTCTAGTACGACGTAAAGACAGCGTTCCTGTACGGAGATCT
CGACGAGATGATATACATGGAGCAGCCGCCTGGATTCCAAATTGATGGACCAAGCGCTGTATGCGAGCTATTGAAGAGCCTCTATGGATTGAAACAGGCA
CCTAATGTTTGGAACCGGACTCTACATGCGAAGTTGGTGACATTGGGCTTTGAGCGCACAGACTCAGCCTATGGGTTGTATGCGCTAAAGGAAGAGGGTG
AAGTTAAGCTGTTATTGACTGTCTACGTGGATGACCTACTACTAATGGGACCCCGAGATCTGTGCGTCAAGATTGCAGCTTCACTGCAAGAAATCTTTGA
GCTGACTACGATGGGTACTGTCAAGTACCTACTTGGTGTCGAGATACTGCTTGACAGACCAAGCAGACAGATTGTTTACTGTCAGAAACAATATGTGCTG
GAAGTACTTAAGCGGTTCCACATGTCGGATTGCAACGGATGTACTACTCCTGATGCTACTACACTGTCTAAGGCTACTGTACCTGCAACAACGGACTATC
TGCCGTACCGTAAACTAGTGGGAGCACTTCAGTACCTAGTGAATGCGTCAAGACCTGACATTGCACATGCAACGAGACATCTTGGCAAGTTCCTGGCATC
CTACGATCATACACACTACGCGCAAGCTAAGAGGGTACTTAGGTATCTAAAAGCTACGTGTGATTACGGGTTGTGATAGACGTACCTGAGGGAACTACTG
CAAATGTACGCTGCTACTCAGATGCCGACTATGCGAATGATCCTGTGAACAGAAGAAGCATCAGTGGCTATGTAAACACACTTGACGGCAACGTAATATC
GTATGCATCGAGAAAACAGGAGATTAACTCCCTGAGTACGTGCGAAGCGGAATATGTGGCGATGGCTGAAGCCACCAAAGACGTGCTGTGGCTTGCGGGC
CTGTGTGAGGAACTGGCCTGGAAGCATCCAGTACCATTTCTATTGGGTGATAACGAGGGAGCAATCTCGTTGACCACCAAACCTGGGAAGCACTCCAAGT
CTAAACACATAGACAACAAGTATCACATGCTGAGACGAAACGTGGAGCTGAAATTGCTTACCACGCACACATTGGGACCGAGCAGATGATCGCGGACATC
ATGACCAAGCCACTTGCGGTGGTGAAGTTCAGTCGCTTTCGTCAAGCAATGAAGGTGTTGCCAGTGGTTGCCTCGGATGATACTACTACCTCTACGAGCC
TGCGGCTTCTACCACGGCTGCTATTGCTGCGGCTACTGCGGAGACTGCGTCTCCTGCTCCGACTGCTATTGCTGCAATTCGAAAGGAATAGGACAAACGC
GAGAAGCACGAGCGATTGCGTTGGATGAGCGTGACAACTACAGTGTGTTTTGAGTGCGATGGTGTGCTGGGAAAGCCAAGAAGGTTGCACCTGTCTTGCG
TAGTTCTACTACGATACTACACGTGCTACCCCTGTGTTAACAACGGACGCTATGACTACGAATGAGACGCTACTGCTGTGGGATGAAGGCCGTGCTGACT
GTCGCCATGCTGTTTACTGTACGAGCTACTGTGCTGCTGGGTCTACACTTTGATCTATGGGGCAGCGACTTTCAACCTGTGAAGTCTTGTGTGTGATCGC
GTGAATCAAGGCGCTGTATTGCCGAGATCAAGTGGGAGTGTGAGATGCCAGCCCCTGTGTGAAGAGGCTAGCACCAGCAGTACATACAAGTGGCCTGTCA
GTGCCTGGCATTGACACTGACAGCCGATCCTACATCCTATCCTACGCCTGTTGCTGCAGCCTGCGGCTGCGCACTTACCGACGTGCCACGTGCGGTTATA
CCAAGTTTACTATGATCGATGGACAAGAGCGACCGTGCCGCCGTGCTGCTCACGACGACACTGACTTAGGTAAAGTATGGTTTATATTAGTTTATGTATC
GAATAGAACTTGCGGAGAGGCGTACTGGCTTGCGTGAGGCTTGCTCTCTCTCTCTCACAATTCAATTTGCGGTTCAGCGAACCTCAGAGAGAAGAGCAAA
CCCACACCAGTACTGCAGCCCTGTCGTGGCCTTATCCCGGCACTCACTGTGTTTACGTACCTCTTTTGATTGCTTTACTACTTAAGTGTAAGTCTACTCT
AATGGCACCTACGCTTAGAAGTGACCTACGCTTAGAGAGCAGTCCAGTGACGCGCCCTGCGTCACCTCAAAACTCCAAACTTTATGTACCTATAAATATA
CTTAGTTTACAATCTACCTTATTTAGGTCACTCCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAA
GATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACACCACCGCGGGTAGACTACCTGAACCTCTCCG
AAGTTCATTGCCATGGGTAGGAACGACTTCTCCCATATGAGCGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGC
AGAGTCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGAAGAACCTGCA
GGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGGGAGAACCTTCACTTATGGGTC
CGAGAAGTAGAGCTCGCGATGAACGCGGCTCTGATCTCGACCAATCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGG
TGTACACACGGGAAGCAACATCCCCTGAATGTTTCACATCCTGGGCTCAGCTGTGTGAGCAGCTCCGAGCCGAGTTCCTCCCGGCGAACTACGAGTACCG
CCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAGCTGCACGAGTACGTGCAAGAGATACGAGAGCTCACGGCGACCCTAGTGGGAAACCTA
CTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTACAGTTAAGCACCCTTGAAGAG