Description :
From Genome Similarity Track
Location :
Scaffold_22:4314- 10666
Sequence
6352 bases(100 bases per row)
TGCATAGCTTCGAATTGATTATGTCTCGTCTACTTGCGTTCAAAATCTTGCAGTAAGGCTTCACGATTCAAATCAAGTTCTTCTACCCAGGAGGGATCTT
CGTATCCATTCCAACGAACGAGAAAGTCTCGTTGCTGTCGCCCATAACGTGTTTTCTTACCAGTGCGGCTCTCCAAAATCTCTTCGACCTCGTATTCGAC
CCCTTCCAATTCTCGTACCTAACTGTCTTCCAGCAATAGGCATTCGTCGAAATCAACCTGATCTGCCTGGTCAACTGATAGCTCGTTGTCTGGTCGATCA
GGAAATTTCCTGACCTGCTTGAGCTTGAATATGTGTACAATAGGGAGCAGCCGTTTTTTCCGCCCCCCGCGTCTCCCAACGTGCTGCATGGCCTCCTACC
ATCTCCAGAAAAGACACGAAACGGTCCGTGCCAAAGATGAGCCAGTTTCCTGGCAAATCCTCCTTTTACTCGGTCGAGATAGAGCCATACTTGGGTTCCC
GGTCGAATCTTGTGGACTACCACCCCTTCGTTCTGCAATTGCACTCGCATCGGACTCGCCTCTCGCAGTGTCTCATTCACCTGCTCTCTTGCTCGCTGGT
ACTGGATCTGAATGCGATACCTCCACCTTCTGGGTTCAGACTCCTGACGTTGGACGTTCACTGTCGGTAAAGTGGCTTCAAGGGTTGACCTGGCATCCCA
ACCGTGGACCAAATATAAAAGGCGTTTCTTTTCGTACCCGGTCCTGAGCGGTATTGATCTTAAGCGTTAACGGCTTTGCGTACTCGTCCCAGTCTAGATG
CCTTACGTCCGCAACATACAACTTGATAGATCTGGTTAGAGTCTGGATCATCCTCTCCGCCGTACCATTAGATTGGGGTCGGTAGGCCATTGTCGCTTGC
TGACGTTGACCCGCCATACGGATAAACGTTCGGAACAAATCTGACTTAAATCCCGTTTCTTGATCATGACAGATCGCCTTGGTAGCCCCAAAACGACGGA
AAATACACTCTTCATATCCCCCATCGACCGTCTGAGCTGTCCACGACGCGCTAGCCTTGGCCATTAATATCCGTTGAATAGATCAACCCATATCAGAAGT
TCTGCAAATCCTTTATACGACTTAGGGAGAGATGAGATATGGTCCATCGCTATAACTTGAAAAGGATAAGTCGCTTCGACACTCCCAGGGCTCCTCCCTT
GTAGATAGGTCCACCTTTTCCAGTCGCGCAATCCATGCAAGAACCCCCATATCTCTGCACGCTCCGAAAAATACATTTCCAGTGACAGAACCGTCGTATG
CGTTGGTAGGTACACCCAATTCCTTGATGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGCAAGTTAGTCTGGAGACTTTCCGGTACCACCAGTCTGA
CCGTCATGTCGCGGCCTTCTCCCTCGACTATAGAGTTGGACAATACACCAACAATCCTTACTCGCTGATATCGTAATCTTCGTACATTTTGCTACACTTT
TTAGCGGATTCTACCGACAGGTCTCTTCAGTCCGCCTTCAAATATGCATTCGAATCTCCTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTGCA
TGGTCCCTCCAGATATCTCAATAGGAGATCGCGACTGAATTACCACAAATATTTTAGTATAGAGACTCTGGTCTTTAGGAGCTAGCAGCTCATCAGACGA
TTGATCACGTCCAATCCTGGTCTTTCTTCACTCGGCATAGACTTGATCTCCCCTTTCTGGTACAAGGCTGTACTAGCCAACTGATTTGCGCTTCCTGGTT
CCAGTCTCGTTTCACATGCTGGATCCCGTGAGAAGTCCACGATTGGAGTTCATTTGAAGCCCGGTCTCGCAGTGATGATAGACCCTAGGCCTTACACTTA
ATCTCCCGTCGCATATGCCGTACCACTAATTTGGAGTCTCCACAGATAATCAACCGCCGCCGCTCCAAAGTTTTCAATAAGCTAAATCCAAGCAACATAC
TATCATATTCTGCCTTATTTACCGTAGATGTATCGACATATTTGGAGGCGGCTTCGACTATGGTCCAAGCTGAGAGTCTCCATACGATAGCGCTAAAAGC
CCCGCCTCCTTGCTTAACACGGGCCAACCCATCAAAACGCATTACATATAGTTCTTCTTCCGGTTCTACGGTTGGGGTGGGTAGGTTGATCGTCTGCCAT
GCCTGATTCTTAGGGGCAATGGCCGACAATATTGAGTCTGCACTCTATCGAAGGGTAATACTAGCTTTCAATGCCCCCAACACCTGGTCTTCACCTTTTT
ACACTTCACGATCTCCAAGGTCCACTGAGCCTAGAGAGCGTCCCAGTTTCCCAAACGCCCCTGCAAGCCGGCAGATTTCACTAACTACGTCAATGTCGAG
TATCACGTCAAGACTTTTAGGGGCTGAGTGACCAACATGGTGAAGCAAGTTTCCAGTATACGTAATAAGACTAACACTTCTTCCTCTACACTACTGTAAT
ATAATTCGTTAGCCTTGAGAGTTATGCTTGTAAAAGCCGGCATAAGCAGTTCTTCATAATACTTTACCAGTGACGCCGAAATGGCCCATTCACTTGCATA
GACAATAATCATGGCTTCTCTGGTCGGGTTGAAGTTTCTCAGAATTGGCGCCGTGGCAATTTTATTCTTAAGCATGGCGAAGGCCACTTGGACACGGTCC
ACCTTTCTTCTTGTTCATCCTGGAAGTGGCATTGTTATCTCGTTTTAACTGGTTTCGTCGGGCATGAAAGTCCACCTAGCTCAGTTCTTAGAGAATAGAT
GCATATACTGCATAGTCTTCAATAAACCTGCTATAGTAGTTCGATCTTCCTAGATAGGATTGCATAGCTTCAGTGTCATTGGTAAAGGTAGGTCGACTAG
AGATTGAAGATCTTTCGGGTGAGCCTCTAGTCCTCCACTAGATACTCGATGCCCAAGGTAGTCGATCTTCCGACATCCCCACAAACCCTTGACTGCGCAG
ATCGACAAATTCCAGTAGTCGCACACATCAAGCAGTCGTTCCACTTTTGTGCACAACGCATCCTATGATTCGACAGGGATGTAATCTATATATGACCGCC
GACTCAGGATCGAGGAACTAGACTGCTCATCTGGCTCTCTCACCTTTAACAAATCCTCTGACACATCTGCCTCTGCTTCTGGAGGTATTCGCAAAAAACC
ATATAGAGCGTTATTCAGGAGTTGCTAATATATTTGGTGCGCGTTCTTAAGCCCAAACGGCATCCGCATCCATTCAATCAGACCCAGTGGAGGCAATGAA
CGCCAAAATTTTTGGCTCTCTCTCTCATTCATACCTAGAAACCACTTGCCATGTCAAGCGAGAAGTACGACAATGCTCAATCCAAGTTTTCGAATAATTC
ATTAATCAAAGACATGGGATAGACCTAAGTTGAGTCAGGTCATTTACCAACCTATAGTCGATGCACATCCTGATGTCCACCTCATTTTTCTTCACAATAA
TAACAAATGGGTTGGCCCAGGGTGAGTTAGACGTCTGTACAATTATCACAGATAACATCCCCTTGATCAGGTCGTCCAACTTCTTCTTGAATTGAAGACC
ACTTTTTGTGCGCGTTGCACGTTGCGAATCGGATTTGCATTTCCCACATCAATATCATATATATCCCCTCGGCCGGCTGGCGGTAAGGCATCCACTTTTC
CTATCAGCAGATGTCGTCTTTTCCATATAATCTGTCGTAGCGAGTCGACATCTTCTGGATTGATCCCATCCGGATCAGGAATCTGTATATCTTTTAACCC
AATAGTCTCAGAGCAGGAGCCCATCTCCGGTATTATTACCCATCATCGTTTATGTCTTCAGCCCACAAGTCTCTACTTTAGAACGTATAAACTTGTTCAT
CGTCCCGTAGCGATTCATTGGCCTAGGCTTTTTCCTCATTGACTGCGATCTCTACCAGTGGATCGCCTTTGGGACCACTTCGTTCTTGAGGGATTTCTTC
TCGTAGAAGTACCTCTTCTTCGCGTGACTGTTCTTTTCTCTCTGGTAGCGGCTGGTGTGACACCCCACAATTCATCATTTGGACTTAGGTCTTTGAACGT
TGCAAAATATGCGACGGGATATTGTACTGCGGTGTATCCACCAGTGGTGTTTCTTCTCCTTCCTCGAGGTCAACTTGGGGGTCGAGATGGTCAGTGGTTG
CTTCATACGCTAGATTCATCCACTCAGCGTACCTTCAAAAACTCACTGAGACGAAATCTTGTGCTCTTGGTACTTGATTCTACGTCAGCCACATACCTAT
CTTGGTGCCATCATGTGATATCAACGTGTGGGGGCTGACGTTGGTCACCTTCATCAATTGTCGGCGTTCTATCCCCCGGGTCATTGTTGTAACCCGTCCC
TCTCCTCTTGTGGCCCACATCTTCCATTGTTCTGAGGTCAACCTCTTTAGAGGTATTTCCACACACCCACCAGCAAGTATACACATATTGTCCCAACCTC
ACGTCTGAGACTCGGTTATTGTAGACGGTCCTCAGTCCAGAGAGTTGTATCCGGACTTCGTTAGAGAGGCAGAGTGTTTTATCCACCAGGTCTAGCTGGA
TAACATCCGGGACCATGAAGTCCATTCCCAAAATCGCATCCTGAACCACCATAGGGCCTACCTACACCTTGAAAACGTACACTAAATTTCCATTTAGGGT
GACCTTGATGCGAGTGCGCCCTTCCCGTGAAAGCACACCATTCCCCGATGCCAATGCACTCTTTTTGTTCGCTTTTGACAATTTGACAGCCTATCTTACA
AGCAAAGGCGACATCCAAAATGGATATCTCGGCGCCTGTATCGAACAACAAATTATCGCGATCGTTGTTGATCTCCCCCGATGCTTTGGCTTGTTTAATC
CACTTAGTAGGGGCATGATATTTCCAGTATCCTCTGGATTCTCCAGGCAGTAGTTCTAACTCCATCATTGCTTTTTCTCGGGCGAAATCATTAGGTTCAC
TGAGAGAGACAACATGGTCCATAGGGTATTCTACAATCTCCGATGTACTATCGATCTTCTCAGTGGAAACCCCCCTCTCCTCTATGGGCTGCTTTTCCAC
GTATGCAACGATACAAAGACTAGAACGCTCGACTCATACCAGATTCAACCTGGCGAGCGTTCTAATTTATCATCTTTTTCAACTTTCTCCGGCAACATTC
CGGCGTGCTTGGTGGGGTTGTACCATTGACGAATCAAATTGTAGAAGTCCTCTAGCTGGCATTTCCCCGCTTCATGGATGTCTCCGCATACACGACACAC
GAACGAGCAGCGATCTGATGGGTTACCCTTCTTCCTGCAGTGGTCACACGTTATTCTCTTCCAGCACCTCAATTCTCCATGTTTTCTGGATCCGCAGTGT
GTATATCACACGTTCATCTCGGCCGACGTATTGCGAGGTACCGGGTCTTCTGCTTGTTTCCGATGTTGGTCGGCCTCTCTGGTGGGTCGCTATCTCATGG
TTCTTGAACTAGGGTCCTTTTCCGCTTCCGCTAGGTAGATTCGTCTCAGGTCTCCCTTGTTATCCGAATCATCCAGGCTGGATACCTCCGAGCTCGACTC
TTCTAGGGCCGCTCGAACTGCATGCACGGAACGGAGGTTTGCATCTCTGGGTCGATCCGGAGGAGCTGGCACCTTCTGCCGGAACTTGATGGAAAAAACC
AGCGTCTTTCCACGCCATGCCTTCGTCTTCTGGCTCGCCTTCAATAATTTGTCCAGGTCTTCCACGTCTGCCAGACGTAGCATCGTCAACTGGTCTGCCA
ACTCTGGGTCGTCCACGGCATCGATGTAATGCTCGACATGTTCCTAATGGATCTTGGGCAATCCATCTTTGATCTTCAGCTTCTCCCTGAAAAAATGACG
TTTAGGTGGTACAGGTAGTCCAACGGGTATTCGCCTGACCTTTTCTTCGCGTGGTAGTACTGGCGGGCAACTGGTACCCCCAGATGACAAAACTGCAGCT
GGAATTCTTGCAGCAGGTCTTTTCAATTTCCTCGAGCGAAGCGGACCAATTGGCGATACCATTTCTGAGCCGGCCCGATCAGCAGTCCTTTGAAGACAAG
ACACTTTTTGCTGTCCGGTAATTGGTCCCTTGCAAAGACCGTCTTCACCGTGGTCACCCAACTGCGTGCTCGGTACTCTTCCAGGTCTAGACCATTGATC
TCTTTGAGGTCCGAAGTTGCAGAAAGCTTGATGCGAGGAACCATGTTGAGTACCTTTCCCATCGTGACATTGGCCATCCTCGCCGAGGTCTCCTTCAGAC
CTAGGTCATCCGGGTCGTGTTCGCACAAGCCGACCGATTCCATGTCGACGTC