Description :
From Genome Similarity Track
Location :
scaffold_57:43130- 45565
Sequence
2435 bases(100 bases per row)
CTTGAGGGCAGGGTGCAGTGCTGAAATTGTAGTACAGCAGAGAAATTGGACTTTGGCTATGCCGAGGAGAAGTGAGAGATTTCTTACCTAGCGAGTAGGG
CTTCAATACCCGCAGATGAAACATCTGTGCCTACCCTTGCTTTCAACAACAAATTCCTCGCAATTCAGCATCAATTTCCAGAAGCTCGGCCAACTGGGAG
AGAACTGAGCTGAATCGTACCTCTTGGAACTCGTAGTCAATGGAGCTTAGCTCCAAAATATGCGACTCTCTCACAGACGAGTTCACAGCCCAGGGTTTAT
GATTATTGATAGCAGCATCCCGAGCTTCTGAAGTCGTGAAATACCCAAATCGTTATAGGAGCACCGTGCAATTGCGTACGACGTGCGACTATTCCAAACG
GTATACAGTACGCGGAGGCATCGAGAGTGTCAAATATGGATAATTCGGTTccgtgcgtcttgcaaaCAGGGGCGATGTGTAAGTGCCTAAGGTAAAACTG
AACTTTATAGTGAGGTGTAAGaaatttgacagcgtggGTAGTCATTGCGTGGCTGGAACGCTACGAGTAAAGGAATGGGTCGATTGGAAGTAAAGTAGTA
AGGTTCTACGGACATTTTCTCTGGTGGAGCATTGGCGAGTCGTGAACCTACCACTTCCAAGAGACAGAAGCTCTGCTGACCCCGATAGGGATCTACGATA
GCTTCTGTGCAGGCATGTGTGTGATATGAGATTTTTCGAATGATTTGCAGATTTTGCTAGGGCAGAGCTTGGGCTCCAGAAGCGACAGTATATCAATATC
TCGGGAGACGAAGCATCAGGGCGATTGCATATGGTAGCCTTCAGAGCGTCTTTCTTTCGAGGCATGAAAGAACGACTATTTCTTGTGGCCCCCTGGGTAA
ATCTTTGGCGGAGGGAATAAAACATCCGTGAGATGTTACTTCCTGTGATTGGACCGGTAGAAAGAGATGTGACTTCATACCGCGGTCTGCCGTACCAGAG
CCGTTGGAAATTGATGCGTGACTAAGGTCGCAAGATGATCAGGTACACTCTGACAATTACAAGGATGGTTCATCCTTGTCACGATATGTAGATACTGCTG
GCTCAGCGCTACCGTGGGATGTGCTCACCGCGCGGATCTGTGAAGTTTAACGGATAAGTGGCGAGAAAGAAAATCCGTTTCGGATTTTGAGTGACCAGAG
TAGTCGTAGATTTTGTTAGCCTTTTCTCACAAACCTAGAGATAAACACCCGTGTGAAATGTTTGCAAGAAGCGCAAGTCGGTTACGTCACCGCGGTTGTA
CAGATGATACCAGCAAAGGCGCCTGGCTTGTCATCAGTCATGGATGAATCAATCATAAGATCATTCGTAGAGCACTAACAGCACAGAGTAAGACAACTAT
TATCAAATACATTACGAATGTCCTTTGTAAAATGAATATCACGATGTGATGACGTGAAATTTACCAGCGTGCTTCTTCTCGATTTGGTCGTTTACGATGT
AGTTGAATTTTGCGaatcaaatattgcgtcacaTGCCAACGGCCTTCATCAATGAGACACGAGTATTTTTCGCTTCTTTTTTGCCAACAAGGATGCAGTT
TTAATGAGATAAGGCAAATTTTCTCACTTGTCGTCGATCTCTTCTCTTCGGTATGCGTAGTCAAGATTCCGCGGTGATTCGTAAAGAGATGTCAATGTCT
CTCGTTGAGAGCTGATAAGAATCATTGGCGAGGTCAAGGGAACCTAACAAAGTACAACCGACCATGTTTTCTGCAGCACACCTTAGCGAGATGGCTTGAA
TAACCCAGCGACGTGTAAACTCTAATCGAAGCACCTTATCAGGGCATAACAAACCTACGTACAAAGCTAATTGTACCATGGAGTTGTCCATAGTCGCGCG
GAGCACGTGTATTCCGATGTGGACGTTCACAATTTACCCTTATGAGCAGTGATGTGTGCTTTAAGACTAGCGGTTTGCCACTTTAGACTACTATGCCTTT
ATCGCCTACAGATTTATGATTGGAATTTATATCAGGACTTGATAAAGTGACTTAGTCTGGTCagttacttgcacaagtacggTGCAAACTAGGCCGACAT
GTCACGACCCTGATACATCTTCATTGAAAGGATATCAAATATTATCGGAGTGCAAGAGTCAGAAACCAGGCTGGCAAAACGAGCCTTCGTTTTTTGCTTA
CAATACAGATCGGCGACTTCACATCATCTGGGACGTTTCGACCCTGAAATTTGATGCATTTTGCCTCAAGCAGATACCAATAGGCATGAACGCATGGTCG
TGTTTGAGTCTCGTCAACTGAAAGCAGTTTAAAAAACAACGCTGGGaatgacaagaagccaatTGCAATGAAATATGCCCTTTTTGGTTTCAGAGTGTAC
CTTCTTGGCTCTGATAGTTTGTGGTCTATACAGAT