Description :
From Genome Similarity Track
Location :
Scaffold_66:43129- 44398
Transcript NameFunction/comments
Phyta_totarag2720conserved hypothetical protein

Sequence
1269 bases(100 bases per row)
ttagtctgacaaaatattgggtcagcagtttgaatcCTGCCCGTTCAtatgagttcgagtaatAATTACTCGGAACCGTACGCTAAAGTTTTAATACGCT
GTGGAATATCACTGAGTATTGGATGGGATTTCGGTCCACAAGCCAATTATTCACACACTTTCAGCAGATTTTAATCATTATTACATNACTATAAATGACA
GAAAACATCTCAAATTCCGTATGATCCAAACTTAGCTTCTAGTGGCGAAGACTGGAAGAAAGTATTTACGCCCCGCCTGCAAattatccgtaatttatca
aAAGAATTTTACgaattgttcttgttcaaatCTACTCAGTTCTCTATTGTGTAGCAAATTCTCACTGAAGTTGGCAGGCAATAGATGCAACATGTTCGGC
AATATGGTGGCCGGTAGTGTGGCTGTAAACACCCATACCTGCATTATGATATAAACTTACNGAtgtcagactatttagtgtgagctcgatgaaatgttgc
ttacataaattagtctggaccagactaattactgtaagcactaCACGAAGATCTGTCGGTGAGGTGGCGGCGGACTGGGAAGGTTCGTCGGCACTTCGTC
AGTGCTGGGGTCTTGGAAGAAGAGTGTCCCTGAAACGAGACACGAATCTTCGGGTAGTTTTGTCGCGCAAGCTTGGATGAAGCGGTCCATTTCGATCTGT
CCCATTCTTCTGGACAGGTGGTTCGTCTGCATTGGCGTAAGTGGCGACAGGATGGTGCCGCGATAGCCCCCGGACGACTGTGCGAGGTAAGCCATTGTGT
CTTGGATGAAACCATCGGCTGTGAGATTTCCCCGTGACTCTGTCAGCCATTGCGAGGGCTCGAGATCTGGCTGTTCTACTGGAACGACGTTGTTGGCAGC
GTTGATGAACTCTGCAAGCAGCGTGGGATCCCACGCCAGTAACATGCCGTGAAAACGTGGTTCTGTAGCAGGAGCGGTGGCGGTGTCAGCGGAGGCTCGA
GGTGCCATTTGCAGCTGGCTTGGTTGGTAACGTGAGTTGGAAGCTCGATGTGTAGCTGGCGGTAAATTGTAGAGTGAACGGGCTGAGGGGGAGCTCACTT
ATCGATCCGGCTCAAGTTGTGATCAGCTATCGCTCTGCGGAATCAACGCAAAACATGACACGCTAAAGTCACTGGCAGCTGCAACCAAAGGATTCCACCG
CAACTAGTTCCGCCTGAGCAATTGCTCGGGAGCAGTCAATGCCTCCGTGCGGCAGATCGGATCTCGTTG