Description :
From Genome Similarity Track
Location :
Scaffold_18:431125- 432504
Sequence
1379 bases(100 bases per row)
GACTTCCTGTTCCCGGATCCTTGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGCTCGGACGACGTGTCTGACTCATCC
TCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCATGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTC
GGGCAAAGAAGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATTCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAG
CAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTTGTTGGTGCTCTCACCGGTTCCCTTGGACCTTCGGTCTGTCGTGGATTCAGGATC
TGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGT
CTTCTTCCGACTCTGGACCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTGCTTTGACTAGCGGGGTTGGGTTTAAATACGG
TTTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTC
CCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGG
ATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTG
AAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCC
CAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTTCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTTGGT
AACTTCCGAAGAGCTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGATGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGCTCGTGGGTA
GTTCCACATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGCATCTGGTCGTAGGGTTGCCTTGCGGGTGTGTTTCCTTTGCCTTTGC
GTTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTAAGAATTGAGAGCCCATAGGGTGTAACCGACCAAG