Description :
From Genome Similarity Track
Location :
Scaffold_59:4310- 8267
Sequence
3957 bases(100 bases per row)
CGCTAATTTTATTCATTAATCTGCGGGTAATATGCTGTGAAAAATCCAATCGTCTGACAAGCACCTCGGAAATGAAATCCTAAAACGTCCGAATGAAGCG
ATTATCGCGATCAGAGATGATTGCAATTGACAATCCTTGCTGACAAAGCGATCGATAAACATAATAATTGTACCTTCAGTATCAGTGGATCCCCGATTAT
TCCCTGAGTGATCCATATTACTCAAATGGCCAGCAAAAAGATCACAATTTCTATCTTGCAGTTGCTCTAGTTTATGAGGTCGAATAGTACATCCTGGTGG
ACTTCTAACGCCCGAATGAAAGAACAAACTAGCGAGGGGCTCCGCCGAGTGTGCCAAGGGTTTGACGCGCTGGCTCGTTTCACATGTGCAAACTTACATG
CCCACCTATTTGAACAAGATTGGTTCACCGTTAGTGTTGACTCGCAGAGCTGTAAGTATTTTTTCGCCCATATGCCCATTGGGTCAGTGTCATGGGCCGT
AAAGGTGATTATATACTATAGCTCCTCGTGGTTAGGCACAATCATGCAGTGATTGTACGTTTATTCTTGCAATCGCACAACATATCATAATTAATTGAAT
ATCGATATAGTCTAGAACCTAGCCGTGACGACAACTAAATATCCGAGCCTTTGTATGTGTCCTTTTAAATAGTTTAAAGCAGTGCCACGTATCAAGAATC
GTGTGTACATGCTGCACGGAATTTTTTTGCGATGTGTGACGACAACTTCGTAACATGAGCAAGCTCGGACAGGATGGTGGTAGAGCGCATCCGCGAACAC
GTTCTGACTTCCTGGCTTGTACTCGGCCTCGCAAATATATTTTACAAAGAGCAAAATACAACGATCCTTTCTCTTAATGGGGTGTGGCGACTGTGTATTC
GTACGAACCGACGTGTAGTCAGTTTTAGACGATGAATCGCTTGGTGCAAAGCAGAGAATCTCTACATTAAACAAGAGCATTCTTCATGGCATGTAATGTT
TTGTCATAAACTTAAACGGTTCTTTTAGCATCTTCGATCTGGCGAGATAAAAAAGCGATAACACGTTCACGGCCTTCAGCAGCAGTTTGCAACAGAGCGG
TGCCTATGTCAATATCAGATGCGCCACAAACGACACTAAAAGGGTCCTCGAATTTAGGTAAAGCAAAAATGGAACAGGGAGAATAACCTTCTTAACTGAT
CGGAATGAGTTAGCATGGATGGTATCCCAGCACTACTTCGTGTCCTTACTGAAAATGTTAGTTAGTCGCTGAGCCATACAATCGTAATTTTGGCTGTATT
TGTGTAAAAACTCGTCAAGGCTAAGCCAATTACGTCATCTTTTTGTTTCTAAGGAATCGGCCGTTCAACTTTAGCTTTGACCTTGCGGGTTCCGCGCTAA
TGCCGGCCTTTTAGATTATTCATCCTATGAAGGGAATATCCTTGGAACTTATGATGCACCTAGATTCGTTGGCGTACGATCTTTTTTTCGCATGCACTTG
AGTACTGCTTGTAAATGGTCTATGCGATTGTCAATATCCGACCGCCCCTGATTTACAATACTATGACCATAATGTCATTAAAGCATGTCTGTGTACGCAA
ATCCCCAATGAGGGCAAATATTTGCGGCATTAGACGATTAAATGTAGCCGGAATAACTGATAGCCATTTGAGCATAACCACTCCCATTTCAGAACACTCT
GAGTGCTCACTGCTCTAAGCGTAAATCACTCGCTCGCATAGGCAAATGTAACTCCCATCGAAAAAGTCAAGTGCGATGCACGTGGTACAACCAATTATGT
TGTCTAGGAGAAAGTTCTTTCGAGGAATAAATATATGTACCGGAATAGTGACCGTTTTAAGCTTGTTATAAGCTTGTGCAATACAACCTACCGCTCTGCT
TTTTTACACGGATCGTCGGTTTCGAGTTTAAAATTTTACTCTGACGTACCATTTCTGCCTCGTGCTTTTTTGCATGGAAGAATCCATCAATAACATGACA
CTGTTCCTTTTGTAAGGATCACTGTCGTGTGATACATTATTGGTCCGAGGGACCAAGTAAATTTCATGACCTGCACCTCTATACGAGAGTACAACCGAGG
GTGGATTGTGACACACTTATCATGATATTCTTTGACCAAAGAATAAAGAGAGGTTGTGCATAGAATTTTTAATACTCATGATCCAATACGCGCACTGAGG
GCCGACGTTGTGTTTGAGAACAGCCTCGTCCACAAGCGAAGTTGAATTAAACTTAAGATTGTCAGGTTGAAATACCACCACATCTGAAAGGTCATTAGAC
GTTACTGATGGACTAAAGTCATCCGATGACAGCTCTTAAGTTCTAGCGATCATTTAACGATGGTGTAGACATAAACTTATTATCTTATGACACATGAAAG
CTTCGTGGATCAAACTAGTCATTGGGTTTGAGTCAGAGCACCTAAAGGTCAATTTATTCGTGCCTCTAAAGCTGACATCTTCATCTGACTTAACTTTCTC
TACACGAGAGCCGATGTCATCACCGACATTCGATGACAAGTCAATTGACTTGAACTCGACATAGCGTGGATAACGTGCCACTCCATCCGCATTCAATTAG
CCTAGCTCTAGATACCTTTATATATTATTAACAATGTCACATTAACAATTAGTTCTTCGCTACCACAGTCAGCTTTACTCAGTGGGTACATACATGCCAC
TACAAGATTATCGGATAGGGACATCCCTCATTGACGTGACGCGTGGTCAGCAATGCTTTCATCATGCAGTAATCTTTTTTCGACGAATGTCACTAAGCGG
AGTATGTGCAGTTTCACTATCAAATACCAAGTTTTGCTCGGTATTCGTGTCTTCGATATCATCAGTGCAACAAGTGATGACGTTTTACTGTCCGCCACAC
TGTCTACTTAGCCAGTAGATCGTGTCAATAGGTCTTCTGATTCCTTGCACGGGTGGAGTCATGAATCTACAAGTCTACGCTAGGAGAAGTGCGCGTTGCA
CTTAATCTTTTGAACCTCCAATCGAACCATGGCTCATGTCGCTTAATCCACGTCATTCCAAGGATTATATCACATTTCGAGTCCAACTTAAGGACATAAC
AGCGTTCTTTAATGTCAAAATCAAAAACAATAAGGCCTAATTTTACAGGGAATTTGCCAACATTGACTCGAGTCCCTGTCGCTTCGCGACCAGTGATCGT
ATCACGATTTTGCGCTTAAGTGCCTTATCATGCTTATTTCCTTCAAATGTTCCATGTATGACCCCCCCTTCATCGTTCGTACGTCCGAACTAATCTGGAC
GTCCCAGAGTCGATAGAAATCGAATAGGGCATATTATAATTCGAAACAGTCGATCTCACGGCCTACACACCTGTCTTGTGCTCTCGTCCCGTCTTAGAGA
TCATGAATTCCTTTAGGGCTAAGTTCTGCTAACCGCTACCTCAAAGAGAAAGCGCATAGCCTAGTTCTTCCTCACCAGGTTTTTCCACACCTACTTGCAG
TCGACGTTTTCTCGCGCCGTACAAGACTTCTGGTTAGCGACGGTATTTGGACTGAGGAATACTGACGTGCCTTACATCAAGGTCAATCGGGGCGCAGAGG
TTTGAGCTCCTGCACGTGAAACATCGGCGAATGTTACAATACGGTTTCACAGATCAAAAATCCGCTTCTTTGTCCGTTTTAACGCGAATGAAGTCCATCG
AATCCGGTCTATTGGATGAACCAAATGCGCTAGACGAGTTTGATATATACTTTAGCGTAACAGGATGGGCTGCCTTACAATTAGACTCAGCGTTCAACAC
GACACCCACAGCCGACTCAAAGGAGGTGGGGTGGACCTGTAATATTTTCGTTCTGGTTGTTCCAGTACGAGAAACCTTTATAAAGGTGGTTACCTGAACC
GTTTCCGGTAAGGGGTAATGCTGTATGGCAGCGACGGGAGTTCTCAGCTCTCGGACA