Description :
From Genome Similarity Track
Location :
Scaffold_624:431- 2509
Sequence
2078 bases(100 bases per row)
GGAAATCTGCTTCGCGCAGCTCGTACAACACCGACGCGTAAATTGCGAAATCTTCAATCAATCGACTGTAGTAGTTAAGACGTCCCAAAAATGACTGCAT
CGATCGCAGCGTCCGATGGAACGGGATGTTCATTAACGATCCCAAATCTTTCGGATTAGCTTCCAAACCTGCGAGCGAGGTTTGATGTCCTAGGTATTCC
ACCTTGCGACGTCCCCAGAAATGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACGCCCTCAATAATCTCTCCACTTTTTTACACAGGGACTTCC
ACGACGTAGCTGGTATCAATATGTCGTCGATATAGGATCTTCGACCTAAAACCGATGGTTTTGGATCGGCATCTGGTTCACCGTCGTGAAGATATCGATC
AACTTCGGTGACCCGGCCGTGGTTGATTCGGATCTTGCGCCGATTTTCAGATACCCGTGCAGAGCGTTGTCGATCAACCGTTTGTAGATCTGTGGAGCGT
ATTTCAACCCGAAAGACATCCGCATCAAACAACCCTGATGGTGCGATAAAGTCGGATGTCGCTCTTGCCCTTTCAGTCATTTCCACCACCCAAAACTCAC
TAGCCATGTCCAGGGAACAGTACCACATGGCTTTATCCATGTCCTGCAATAGCTCACTGATCAGGGGCATGGGGTATACCATCAACCCATTCAGATGGTA
TACACTCCTGTAATCAATACACAGCTTGTGTTTCTCCATTTTTCTTGACGATCACCACTATAGAAGACGCCCGTGGTGATGTAGAGGGCCGGAAGAATCT
TGGCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCGTCGCAATCACCT