Description :
From Genome Similarity Track
Location :
Scaffold_172:43098- 46039
Sequence
2941 bases(100 bases per row)
CTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAAGAGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCT
CATTAATGGATGAGTCAGTCCTAGAAGACACCAAGGCGGCACTCAGTGCCCGGAGTAGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATACTTT
GGTAAAGGAATTTCAAGATGTGGTGTGTCACAACCCACCATCTGGCTTACCTCCCGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAA
TACTGCGTAACACGGCAGTGGCCTTTGCCTAAGGAACAGTGTGACGTCATCGACGATTTCTTTCGTGCTAAGCACGCGGCAGGAATCGTGCGGGAGATTA
AGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAATCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATCCCGGC
TCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTC
ATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCGCGAGCGGTATGCTCTGGGAGTGGCTCGTTGTGCCACAAGGGCTGTCAAATGCACCGGCTA
CTTTTAATAGTCTGGTGACGCAACTATTCAGACATCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAGCGAACGGTCG
AACCGATTTGGATAGTCACATTGATCATTAACGAGCGGTGCTCGAGTGCATGCGCACAAATAAATTGTATGCAAATGCATCTAAGCGCATCTTTGGTGCA
GAAGAGATTCCCTTTCTGGGGTGCTTCAATGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCTATAGTCGATTGGCCGGTTCCAAAGAACC
AAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCAAATTACGCAGATATGGCTCGGCCAGTATTCAATCTCCTTAAGAA
GGATGTGGATTGGTGTTGGGGTAACACCAAACATGAGGCTTTTCAAGAAGTTAGGGAAAGTATCCTTCATGCGCCAATGCTGGCTTTGCCCGATCCTGAT
CGGCCTTTCAGTGTTGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGAACGCGAACGCGTCATTGCATTCGAAT
CTGGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGATCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAAAGTACATCTGCTTGG
CTCAAAGCCATTTGTGATCGATACAGATCATGCATCATTGCGCACTGCGACACAGTTGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTT
GCCGAATATACTTTAGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCTCCGACCTGACTACGAGCTTGCTCACGTAACTA
CGCTGTCATCGTCAGTCACTAACTTAATCCGTGCGGCTTATGCCAAGGATGAACAAAGTGTAGCTTTGCTACGTGCTTTTGGGAGCAAGGAGTTTAAAGA
CTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGACTACATCGATAATCCATCGATAGTGGCCTGTTGTGATATCGCACAGATATTGAGGATAACCCT
CGTATCTCTGTCCCCCATGATGATGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTAGGTCGTGAGAAGACCTATA
GCTCAGTGATCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAAAGTGTCAACGGGTTAAACCCTCAGCACC
TGCGGCGGCACCTCTGGCTAGTCTGCCTTTACCCACTGGGTATTGAAAAAGTCCGTGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTTGGAAGGCA
ATACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGAGGCAGTGCCGGATTTGACTGATGCCGAAGGTACAGCGAAGCTGTTTAT
CGACCGCGTTTTTCGACAACATGGCTTGCCAGTGGCAATTTTCTCTGATAGAGATCCCCGCTTCACTCGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTC
GGCACCCGTTTGGACATGTCCACAGCGGATCATTTGCAGACCGATAGTCAAACTGAGCGTGTTAATCGCGTTATTAATGACATTTTGCGCAGTGTTTGCG
CTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTCTTGTTGAGTTTGCGTTGAACTACGCTGTTCATGCCTCTACAGAATATACTTCGTTCTACGTAAA
CGGTCTCACCCACCCTCGCGTTCCGTTAATGCTACCACTATGTGGTTCAGGGCTTGGTGGCGGAGAGGTTGCCGATCGGCTTCTGATATCAGCCCTGCTA
CTGTTCAAAAAACAGGTAGGCGAGTTTCTCGCAACGCAATTAAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGCTAAGACCAACAAAAACGAA
AAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATAAGGTCGGAGACTAAGTATTACTCAATGTTAAAAGTCTACCTACAAATGTAGTGTCCGCTGT
CTTTAAGACAAAGTTGCGTCCACGCTTCGTTGGACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCACATTGCGCACA
CACCCAGTGTTCTACGTTGGCTTGCTTAAGCCGTATCGGGA