Description :
From Genome Similarity Track
Location :
contig_61:43096- 45738
Transcript NameFunction/comments
g10843.t1hypothetical protein

Sequence
2642 bases(100 bases per row)
TCGCCAATATGGAGCCGCGCGCCCGCCGTCTCAGTAACATCCGCGAGCCGCCGCTGGCTCCGACGTTCCCTACCAAGAGCTTCAGCCATTCGAGCAGCAG
TCGCGGCCTCTCGTCCTCGCGCTCGTTGTCCACGGCGGTGGTGCTGCGACTGCTACTGGGGCTACTGTGCGTTGGCATCGTCTTGCAGTGGGTCCTCTGG
AGCTCCAGCGTCGTGGAGCCGCAGCGCAGCAAGGAAGACAACGGCTGGATGAACCACTTGCGACGAATTGAGCACGCGGCTGACAAGGAAACGCCTGAGC
CCGCCGCTGACACGTTCGAGTTCGAACCGCCCGCCAGCGACCCGACCCACGAGGAGGAGCAGCGACGACGAGCACCGTACGATCCGGCGATGCACAATGA
GGACCAGAAGCAGGTAGTCGAGATGGTACAATGGGCCTGGAAGGGCTACTCCACGTACGCCTATAGCCACGACTCGCTGAATGTCAAGACGTACAAGGGC
ACTGGGCTGCCAGATCATGACATGGCACTGACACTTGTGGACGCGCTGGATACACTATACCTCGTGGGTATGTTCGACGAGTTTGATCGGGCGAGTGAAT
GGGTGGCGAATAATATGGAGCAACGGATTTTCCTCAGTGGCTTCATCAGCTTCTTTGAGACGACGATTCGCCTGATGGGAGGACTCTTGTCGTCATATTA
TTTGTCGGGGCATGTGCATTTGCTCACAATTGCGAATAAGCTGGGCATGGCGCTTTCTCCAGCGTTTGAGGTGTATGAACACGGTATTCCGGCCAAGGAC
TTCGATATTGTGGTACGTGGCATTCGGTGTCTCTATAGGATTTTTTTGTAGGATGCAAACGAAGGAAAATAATTTATTTGTGTTGCTTGGTGTGGTGGTG
CTTAGACGAAGCGGACACGAGCTGCCCCCTCTCTAGCAGAAGTTGGCACACTGCAGATGGAGTTCAAGTACCTCACTCGACTGACCGGATACCCGAAATA
CCAAGAGCAGGTCGACCGTATTTCGGATTCAGTACGTTCTGTTACTAATAGTGAGCGCTTGTGCTGCTTACGATGGACTTACCTGCCTACTTCTTCTGCT
TGTTTATATCATGTAGCTTGCGAAGCAAGTGGAGGAGAAGTACACAAACGGTCTTCTGCCGGTTCAACTGAATCAGCAAAACGGAAAAATCACCCAGTCG
AAAATCACTCTGGGCGCTAATGGTGACAGCTACTACGAGTACCTGCTGAAGCAGGTAAAGTGTAGTGGTCGAATGAACTTAGCTAATGCGTGGCTGACTC
TCTTTGCGTTGTTGATACGCAGTGGCTCTTGTCGGGCAAGAAGGACGACAAGTTCAAGACGCAGTACATGACGGCAGTGGATGGAATCATAGACAAGCTC
TGGGTAAGTCAAAGCCCAATGGCTTGGTATTCATTGGAGAGCTGGTGTACGGCAAGTTCGAGCCCAAGATGGACCACTTGGTGTGCTTCGTGCCAGGTAT
GCTGGCGCTAGGTTACATGAACGGCATGCCTGAGGAGCATCTCACGCTTGCGAAACAGCTCATCGAAACGTGCTACCAAATGTACGCTCAGATGGAGGCT
AAGCTTGCCCCCGAGATCATGTATTTCAACATGAAGGAGAACGTGGAAGAGGACTTACTCGTCAGCGCCACTGACGCTTTCAACTTACTGCGTCCCGAAA
CGGTGGAGAGCTTGATGGTGCTGTATCGTGCCACAAAGGACGAAAAATACCGCGAGTACGGTCGTGATATCATGAAAGCATTCGAAAAGAACTGCCGATT
AGACCGAGGTGGCTACGCAAGTATTGGCAACGTTGCCAAGGGCCCAATTCACATTGGCTTCCGCAACGAAATGGAGAGCTTCTTCATCGCTGAGACGCTC
AAGTATCTATTCCTGCTGTTCTCGGACGACTCGATGCTGGCCTTGGATGAGGTTGTGTTCAACACGGAAGCCCACCCGTTCCCGATAGACAAAACCAACT
CATAGATATGTGAAGGACGCGTCTCCAATATTCGTGCTGCATTCTCGGTGTTGTGCTAATCCAATTCGTGTAAATCGACGAGTGGAGCTTCATGTTAGAT
TAACGGACTGGCCTCTCGTCTGTGGTATTTTCAGCAGCTCTAACGAAACGATTCCTGAGAGGCAGTATTGATCCGTCATTGTAGATGAGCTCATCCCGAG
GTGCAAATTACAGATGGGTGGTGCAGCGTCTGTCCTAGGCGAATCGGCCTCAAATTTGCACTACAGATATGGCGAGGTTACAGACGTGCCAGGCGACAAA
GCGGATGAGGACCCAGTGTCCGCAGCATGGATCGGCACGAGGCTGGACATGCCGCCGAAGCCCTTTAGCCTCGAGAACTACTTCGAGTTGTTGGACATCG
TAGGCACTGGTATGCTGGGCAAAGTACGTCTCATTCGGCACAAGCGTTCAAGTCTGTACTACGTGTTGAAGTCGATCAAGAAGAAGGAAGCGATTGTCAA
GAAGATGACCCTGCAGCTTGAAGCCGAGCGTGACGCGATGGTCCAGATGACAGCAGTTCGACATCCGTTCACGGTGCGGTACTTCGGCAGTTTGGCCACG
TCTTCGCATGTACATTTTCTGATGGAGTATGTACCTGGCGGA