Description :
From Genome Similarity Track
Location :
Scaffold_13:43075- 58710
Transcript NameFunction/comments
Phyke_g922conserved hypothetical protein
Phyke_g923hypothetical protein

Sequence
15635 bases(100 bases per row)
AACGCTACAACGGAAAagcgccaacaccagcaactcATCTGTCACGGTTGTGTCGTCCCGCACCGACCAACGGACGCGAGGATGTTGCCGGCGCTTACGA
CCAAACCCAAGCAGGCGGTCCGCCAGGTGCAAGGCCTGTCGAATGACTCCATCGACTCGTATTCAAATATGCCCCTCGGTGGTGGCACAACTGCTGAGGG
CGGGGGAATGACAGCGACATACGTCGATAACACCGAATCCGGTAGCAAAACTGCTCGTGCATCACCTCCCACGACTAGCCGATCAACAATCAACACTGGA
CGCACTTCTTCCATGCCAAAAactgctactggagcagagGAAGGAGCGACGATGGCTCGTGTCGTTCGCGACCGCAAAGCGTCGGGTGAAGAGGAGCTTT
CATTGTGCACTGGTGACATTGTCAAGGTTTTGTCGACAAAACGGACAGGTTACCTCAAGTGTGAAGTAGGGGATGAAGTGGGCTACGTACCATCATCCTA
TCTCGAGTTTCTGGACGGTAGCAATGGTGGCGCTGTGGAGGGAAACGACACAGCTGTCATGGACGAAGCTCAACGTGCAGCTGAAaagcagcgcaagaaa
cAACTACGCAAGGAAAAACGTCGTAAGGAGAAACGCGAAGCGAATGAGGCAAGTGATCCGGAAGAAGGAGCGCCGGTATCTGTGCGGTCTCCTCGTAAAA
TGGAAACTGGTATGGTGGAGGACGAAGGCAATGAGTCTCCACGTaagagcaagaaaaagagcCGAAAGAACCGGGGTCGCGAGGAGGAGACCCcgcgagg
tgctgctgctaattCAGATGATACGATAAGCACTGCGAGACGAGAATCCATTGAACGGACTGAACGCTCGCGGAAAAGCAAACACTCAAAGAAAAAGCGT
CACCGGGATGCCGACAGTAGTGATTCTAGTGAAAGTGACGGTGGAAGGAAAAGCGGTCGTCATGGACGccgtcgccaccatcgccGCGGGTTAAGTGACA
GTGAATCGGACTCAACATACTCTGATGATTCAGATGGAAGCTACCGACGGAgacgccaccgccgccgccacaGGCACCGTAAAAACTCtagcgatgatga
cgacgaagaggacgactACAAACGACGCTCAAGGCGTAGCAAGAAGCGTCACGATAAAGATGGTGGTGATTCTGAACCCGAGGAAGGATCTCGTTCTGCG
CGGAAGGcagagaaaaagaagcagaCGGCCTCTGTCCAGGAAGTGGAAAAGGGAGTGGGTCAGTTAGATGTCAAAGCTGATGAAAAGGAAAAGACAGTAG
AGCCTGTCCAGGCGAAAACTACTGTTACCTCGTCCGGGACTAAGAAGGATGAGACGGACCGGAACAAAGGAAAGAAATTGGAAACAGAACGCAGCGAGGG
ATCGTCTGAAGGCCGGGCAAGCGGTTTTTCAACGAGTCGAAAGGATGATGAGGGTCGTtctaccaccaccacttcaggTAACAAACAGCAACCCGGAAAA
TCGACCCTGGGCAAGCAAATTGGCGACAAGATGCGTTCATTCCTGGGTGGTGGCAAAAAGCAAAATAGTAGTAAAAGCTCCAGCGGCATCCTCAACGCGT
GTCCGGGTACTACTCAGGGTGAAGAAGGCTGGTATGAGCATGGCGAAAATGAGCGCTACTACTTCGTGCTGCTAGAAGGAAAGTGGAGTCTTCTATATGG
ACCTATGACCGAGGATGACTTCGAAACCTTCTCGAACCGGGTATGGCTCCAATATTTGCTTGCCTGCTACAGCTTGGTTCTAATATTTTGGCGGTGATGT
GTTgcaggtgatggagcaaAATTGCTCAATTGAGTTGCCACCAACGTATCTGCACAAGTCAGGTTATTTCCTCAACCGCGAAATGCGCGTTCAGAAGGAG
CAGTGAATAGTCTATCAACTCTTCCTGCTTCCATAAAATATATCAACAAGTCCAATATTTTGTACTGACTGGCGCACGTAGATACTCTCAATCTCCTCAT
GCATGGTAAGTAGCAACCCCAATCGCGTAAGTAGCCTTGGTAACTAACTCAGCCATTGACAGGTTTTGGTAAACATTACTTGTGCATGTACAACGTACAG
TGTGTAGCTTATCCAACCAAGTTGTCATTTCGTTTGTCCTGGCAGCATTGACCTGGTAGCTTCCAGCACAACCTCCTGCGGGAAATAGTACTCAGGTGTG
ATTTTCTCCTCTTGTGATTTCATGAACAACTTTGGCGGGAGCCGCAACAACTGCTTGAGCCCGTCTCCAAGTGACTGCTTGCGCTCGGAATGCGCATGGG
ATTTCGACTCGATCTTCATCTTTATCTTGTTACCTATCGGCCCTGTTGCCAAGTTTGTGTTCCTTACGAGATTCCAGCTTGTTTGCTTGTCGTGAGGTGa
cagtggtgctgcagcgcgctTGATAGGGGATAActccttccacttggtcTCGTCCGTCGCAACCTCGCCTGCGTTTATCTCGAGGTGAAGATTTAATGGT
TCCTTGCGCTGTCCACGGCGTACTTCGTCTAATTTACGGCTCACAACATTTGTCTGGAGCTCCGAGTCTACCTTCTGTGCAGAGGCTACCAACTTATCTC
GGCTAAGTTCTTCACTTCCCGCTTTTCCTTCCGTGTGATATTTCATTTGCCCAAGAAGTTCTGGTATACGGGTAATATTGAAAATACCTTCCATTTGCAT
TTCCTCGAGCTCTGTGAGATGCTGGCGGTGTAGCGACCAGTGCGACGTAACTACATGATACGCTTCGCGGTGGCGATCATTTAGTCCGCTGGGAACCACG
CATACCTGCTCTAACTTGTGTAAAAGCACCGGTGTATTCTCCGAGTGCATTTTGCGCTTGTTTAAGCAACGCTCCGCATGAGTCACAAGGTCTTCCAGGA
GCTCTAGGTTAGATTGATACCGTTCCTCCAGGTTTGCTTGTGCGTCTTGTTCACGCGGACACAGTTTCTCACACTTGTCACGCACTTCTTTTAGCAGGGC
CTCTGTCTCCACCATGTGTATTTTgtccacagcttcaaagagaagaagacgctgaagcAATACCTTCACACCCACACCCTCTCCAAAAGCATTATCACAC
CACCCGTGCCCGCGTTGCAGCCATCGATTGCGCAGCGTGAAGGCAGCAGATGCCAAATGCAGTCGCTTTTGGAGTACCTCGATGAGTTCAGGTTTATCGG
CTGAAGACACCTCGAAATCTTTCGCTGGAGTGTACCAAAACGTCTTTGGACTTTGATCTTTCGGGGTGGAATAAATTTTCTGACTGCTGCGCTGATTATA
CGGGAAGGTATCCAATAAGTGCATCGTGTCAGGATCAACTCGTGAGCGAAAGCTGGTTGCCTCCTGATACGCATTCGCAGCATAGCTCACAGCCGCGTAG
TATGCCATAGCACGCGTGTTTTTGCCGTGTGGGCAACGTTCCAGTATTTCTTTGTCTGGATCTCGAATATGTCCTGCtcgagcagctgcaagcagctcTT
CACGTGTAAATGCTTCAACCGGAAGTCGATAGTTTGTCCCGATTGTTTTTTCGTTGAGCTTCCTTAGCCCGATCGCAATGTCTTCTTTTGTTACAACCTG
ATCCCGCGGTACGCGGAGTAGTGCACGCATACAACGGTCTTGAGCTGCATACTCGGCAAGACGTTTGGTGTACACCTCGTGCACTAAAAGCTGTTGAAAT
CGCTCCACAAGCGCCAAATAGTCGACACTCAGGTCTACCTCAGCATTCACGACTGCAGCGGCAAAGGCGTCGACTCCAGCCTCGTCAACCTCATGATCGA
GAATGTGCGTCTCAACAGGAAACGTACTCGCAAGCGAGTTTCGTTTGTGCAGCGCCTCGAAAAGTAGTGACTTGCGTAGCATCTCTACATGCGTGTCGAT
AATGCCAAGCCCTGTGTTGAGCGCTCCAAAAGTCTCTGAGGACATATCAGTTGGTCTGTTCGCGACGCCTGTCGCCTGCGTACCGATGCGAATTCCACGC
AACAACACGGGTTCACCTTTGTGGTCCATTTTTCGATCCTGCAACAACGTCTGGATACTGCTCATGTCCTGTGGCAAAGTAACCTCCTTTACTCGGTACT
GATTCATaagttgaagaagcaccGCAGTATTTGCTGTACTCGAAACGTTGATGCCCTTTTCAACCAAAGCCTCTTTCTGAAGTACGAATGCAAGCGATTT
CACTAGGTTCTCAACTTCTGCCGTTGGGATCTGCCGTATCGTCATCTCTCTAAGCATACTATGGTAGCTGTCAGGAACTGTTAACTCGCAGTTCCGGCGC
AAGACATGGTCCACTTTCCGCAGTAAATCAATTTTGCCGAGGCTTTCTATCATCAAGTAGAGCTCGATCACACGTTCTGGGTTGGCCACTTCGTAGGTTT
GTTGATCGTTGTCGCCGTGCTTTTCAAATAGCCCCTCAAGTTCTTTAATCTCATCGAGTAACTTCTTCGGCAGAACCAATTCTTGCGAACCAGTTTTGGG
GTCAAAATTCGACGGAGAAACCCATGCATCGAGTGTAGTACCGGTAGTTCGGCTGAAACCATCAGTCGAGTCATTGTTGGACGTCTTTGGGATCACTCCG
CGGTCTTCTAGGGCGATGCGAACGTTCATAGGAGAAAATATCATTTCTGCTTGAGTGATCAGCAAACGTGCATCAGAATAACTCTTTTTCTCCGCCTCAG
TTGTAATACGGTGGTATGGTttgcgctccagctcgcACTTAGCCTCTTTGATCGCGTACCATTCCAACATCCCCTCTAGCTGACCGATACCGTCGACTCC
AGTCTCGAATGCAAAACTCTCAACACTGCTAGAAGCTTGCTGTCGTAGGCTGAGAGGCTTATTGTCAGCATCGTTCGCCACCTTTGAGTACGACATATTC
GTGTAGATCGGCTTTAAAACCTTCCCGATTTCAAGCTTTCTGCCTGCGTGTGTATACTCTAACATATTAATCTTTTCAAGTATCAACGGTGTGTAGTCAC
AGTCAATTGCGTGCTGTGACTCCATACGCACAACATCTTCCAGCAAGTCCTGAACTTTTAGCCAGCGCCTCTGCACTACCTCGAGAGATCTTGCATCCAC
ATCCGCGAAACCCTCGTACTGCTCGTCAATAAGCAACAGTAATTCGTGTGTGCGCCGCCAGTGCAGTCCATTCTTCTCCATTAAACGCAGTTCGGTAAGA
ATTCCACCACGCTGTGTGATAGCCATCCACCGAAGCTGTACGTTTGAAACTGCCTTGGTGTAACGGGTGCTAAGACCTTTGCTACAACGTTGGTCCACGA
TGTTCAGAAGCTGTGGAGCACGCCCGAGATCCAACTTCTTTTGTTCTTGCATGTCTACGAGCTCCTCCAGTGTGCTAAATAGTATCTTCCACTTTTGCTG
TACCTGCTGCCACGCCGTCCTAAGCCCAGCATCAAGACCCTCCACTTCTTTTTCAATGTCTTCTAACAGCTGAGGTGTGCGCTGGGCATTCATCTTTTCA
TCTGCCTGGAGACTCCTGAGTTCCTCGAGCATCGGCTGCAAATTTACCCAGCGGTTGTGAACTTTCACGACGGATTCCCGATATCCCGCCACCTCCTGGG
CAATACGCTCTGAGAATTGGTGttcttcagcatcaaccTCCTCTCTCTTCTTACAGGGTGACGCTTGCAAGTTTTTTCGTGTGATGAAGATATCCCACAC
GAGGTCGAGCAGTATTGGTGTACGTTCCCAATGAAGTTTGCCTTTTGACTGCTTCGTCAGTTCGTCTAGGTAACCCTTGGTTGTCGTCCACCGATGACGT
TGTGCTGACACGACTGCAGCGTTAATACGCCTACGTGCTTCCGCATGTTGTGCAACATATTTTACTTTCCGAGCCTTGTACACCTTAACAGCTTCTTCGA
GGAGTGCAATCTCAGAAAACTTCAGGTGAAGGCGCAAACGTACTCTGCCAGGGTTTGTTTCTTTGCCTTGGTTTCCAGCATTGTATGTCATTGAGTATTT
GCTCCCAACACTAGGTATAGTCAGAAGCTGGTACACATTGTCATGCGGCTGTTGGTCGAGGAGATCTATGAGTGGTATACACGCAGTGCCCAAATGGTTG
TCGCCCGTGTTGCTATCTGCGTCCATCACTTTCACTTGAATTGTCGTGTGCATAACTTCCTCAAGCACTTGACGCAATTTAATGAGTCGGGAGCGCTGGT
AAACTCGTTGGTAAACCTTTTCATCCTCAGCTTCTAGCTCTTCTACTTCCTTATTAAAAAATAGTAACAGTTCCTCACACACTGCGACATCGGCACGGTC
TCCTTGGGCATCCAGCTCATACAGTTCTTCCAACTTCGGAAGCATGTGGACTGAAAACAAATCGTACAGCTTTAGAACAGTGTGTCGAACACGAGAAGCA
CAGCTGTTAATATTGGCTTCCATAATCACCACATCGCCATGGTGCTTAACATCATTTTCCTTGTCGCGTGGATCGGATGACCAAGGTAGTCTTTGGCTCA
TCTTGTCTTCACCAAATTTCAACGTCTGAACAGTTTCTTTTATCAACGATCTTGCCTGCCGCAAAGTATGCTGCAACTGCCCGAGAGCATGAGAGGTCAA
TTCTGTCATTAACTCACGGGTGTCGTTGGCTTCAGCCGAAATTTCTGGTGTCACTGATCGAAATTCCTTGGCTGAAGCTAACAATGTCATGGCGTCGAAG
GTCAGCTGAACGCTTATCATTTTTTGTAGTTGTAGCTCCATTTCACCAGGCTTTTTCCGCAGTGCTTTCCCTCCACCAGAAACAGATGCAAGAAGGGTAC
GCTTAAGATtattttcttgttgctgaAGCGACATCGTTAACAATTCTCGAGGGCAGATACTCCAGAAATCCAAATCCGTTTTCAATCGCTTTGAGTACAC
TTCCATACcagctcggcagcgttgaaGCCGTTCGATACTCAGAAAAATGTTTCCAGCCACGTGCATCCGTCCGTTCTCTTTTCGAAGCACGCTAAAGCTT
CTGTGTAACTCAATATTGCCGTTTTCCGCTTCAGAACGCGCCGTACTAATGATTTGACTCAGTGGAATAGTCGCAGTTCCGATTAACAACTTATTGTTCT
TGTCGCTCTTATCCACGATTTTCAGCTTCACCTTCAGTTCCGAAACACGGCCAAGATCAATGGACGGGTATGCAAACTCTGCTACCTTTCGTGCTGAATC
GGTTGTATCGACAGTCCATGCTGCTTGATCTCTGTCATACTGCAATGTGAAGGTCGATTCTTTGGGATAACGATTGTTGCTCATATCTTTAACGATTTCA
CCTGTTGAAGAGAGAACTAGGCCAAAGAGGCTGGTGTAAGTTCCGTGTTGGAAGTCATTAGAGACGAGTAGAACTTCTACGTGGACGGAATTTTCTTGCC
CCATGTTTTCTTTGAGCGTCAATTCACTTGCTTTCAACACTTGCACACGGAGTTTGTCGAACCTGACATCGGATGTCGGTACGTGCTCTACGTGTGATTC
GTTCGTGCAATCAATATCCACAAATTCAAGACAGCAGGAAGATGGCACAGGATTATCATCGAGCCACTTGGTACTTTGTTCCAAGAACGCATTCTGTGAA
CTGCACTGGGGTGGTGGATCCTGAAAAGATTCCTGAGTCACTATTGCTTTGAAGAATGGAGAAATCTGTCGGCGAATTTGAGCTTCTACTGTGATCTTGT
GTATCGGGAAATGTAGGTAGTGGACATTATCTTTATCGTCTTGAACACTTACACGGACGTCGTCAAGTGCCTCAAGCTCGAGGGACACTGTAGGTGTAGA
ATGTTGTTCACCATTCTGGTTCGTGAATTCAACTGATAATGCCTTGCTGAGTGTGATTTCGTCAGCCGAAGGCTCAAAGCTCCACGGTACTTTATCTACG
TCTCCTTTAGCCGCCAAAGGTGCACATTCGTCACTCATCAAGATAAATGACCGTATTCTTTGAAGTTTGCTGCAAATCTCAGAAGCATCAGCGAATGCAT
TGCTCACTGCATCTGCCAGACTGCCTTGATCGTTGTGCGGAATGGACATCTGGAACTTGACATCGATGCTCACGCCTAGCATTGAAATACCCGATGCAAC
TTTTTGTTTTATATCGCTGACCACCAGCTGATCGCTTCGCATTGGGAGCGTAAAATTCAACACCACATTTCGTTCTGGATTGCTCTTGAAGCATACTTCT
ATCCTCTCAACTATCACTCGACGCTCCTTGCTTCTAGGTGCAAGATTGGCGTTACATTCCGCACGCAGCTGTCGCTGAAAGAGTCGCATGACGGATGCTG
GAAATTTGCCGAGAGTAGCCGAAAGAAGCGTCTTGAAAAGTGACGCAGATTGGGAAAATGGACGTAGGCGAATAATCCCACGAATTTGGGTGAACGGTGG
TGGCGCCAGCAAAAGACAAAAGCAGTTATTCTTGATGAAGGATTGTGCTGCATTCGCAGTTGCACTGTTTGCTCTGCGTTTGCATGCCGCTGAATGGGTC
TTCCGGAGTTTAGTTGCTACTGCCTCATCCAGCGTTTCCCCCTTGACATATCCATGATATTGTCCAAAAAACCGTGGATGATTTTCACTTCTTTCCATGA
GATTGCCTTGAACAATCTTGTTTGTCGTTGCATCTCGCACTTGGACAGATTTCACCTTGGCTGGAAGTGTTATGTACACCTTCACGGGTTTGTTCTTGCC
CCGCCAAAGATCGGACAATTTACCAGCCATGGTCTTGGCCATCTCGCTACTATGTTTCTCATCAAATATCTGTAGTTTGGGGATGAAAGTCGCTCCAAGT
AgtgctgtgtctgctgcaaaACATTCTGTGCGTAGTCGGAGTTGGCTGCGCGAGAGATTATCAATCAGCTCGCCGTTTTGAAGATGCACATGATAATTTA
GAGCAGGGGTAGAAGAAACTAATTGTGGTGACGTAAAATGAATCCCCATGATGATGCCATCGTACATAGCTCGATCCATTACAGGAAACAAGCGATTGCG
CTCGACCGACGTCTCGTCACTTGGTAGTTGGCCATCTAGGTACATGATGTCATACCGCGCGTTGCCATGATTGCGAATGACTTTGCCAGGACGCGAGTTC
ATAGGTGCCTCTTGAGttattttgtttgtttgtttgcCTTTAGTATCAAGGGGCAGatggcatccagcagtacTATTGTCGGGTATAAGACTGGAGTTTT
CACTTACCCACACGTGATCTTCTTTCTGCAACTGCATCTTTAGGCTATCTCCAATTACATTCGAAAATGTAGTGTTAATGGAATCAATTGTCCGCCACTC
TTCGTGAGGCTCCAGATGATCAAAGTATTCAATCAAACACGGAGCTTGCGGGTGGTGCTTCTCATCGTAATGTTTCATCTGTCCGAGACGCCCTTGCTTG
ATGTCATagatatggctacattgtCCGTCTACAAAGTCCGATTTTTCACTTCTTTTCTCACGCATAATTGAGCCAACGAAGACAACATCGTGATTCTGTG
CGGTTTCTGGATCTACTGGCCTCCAGAAAATATTGACCTCATAGCAGTCATCTCCGCATTCTCTAGCAATCGTAGCAGCAACGAACTGCCCACTAGATAG
TTGTAAGTCCACGGACACTCCAGAATGCTTAAAGAAAGGAACGTAAGCATTTACCAGATCCCCAACTCGCAACGGGCTTTGAGGTTCAGCATTATTGAGG
TGTACATCAGAGTAATCAGCACCACGAGTACCATCACCGAATGTCGTCTCCCTATACAAAGTCGAAAACTCAAAGCCCGTCCAGTCACACTCTGCGAAAA
GAGACTGTATCAGATGTGGTGTCTTTTTGCCATGCAGATATCCAGACAAATAATCTTTCGACTCGCTCACATGACCAAGTATCAGTGACCATCGATCGAG
CACAGTATCTAGTGCCACCGTATTGGCATACGAGAGAGAAGTCTCTCTACCTAAGAACACGAATTCAAGCACATACGCTAGAAGCTGAGGCGTAGCCTTC
CAATGAAGCTTCGTTGAGTGACTCATGATACGTACTTGATCAAGTAATTCATCACTTATTCTACGCCCTGGGAACGAATTTGCTCGGCAAGTATCCCACA
GAAAAGCCTCAACTTTATTTTGCATTTGTGCAAGACCATGCCGTTCATAGCTTCGATTTAACGCTCTGGAATCGAACACAAGTCCAACCATACGGAAGGT
GTCAGCCAAAACTTTTTTCAAGCGGTCAGCCCGACAGATGCCAATCAGGTTAAAATCAACAGTCAACACTACTTTTCGATCCACTTTATCTCGATCCGTC
AACGTTATTTCTTTGTTTCGGAACGTCGCGCATTGATTGGGAGTTCTTAGAAATGAGTCTTTGCCCTTTGACTTTCCAAATTGCCCCTTAAAAACTTTAC
CCAAAGTTTGCGAAGCCAAACATACTTCGAAATATTCCACATTTGCCACGTTGTACGTGCGTCCAAGAACTTTGAACGGATTCTGACCTGAAAAAGAAAC
TGCATCGGAATCACTTCTCACGACCCGCATACCATCAGTCACATGACGTTGCGCAATATGAATAAGATCACTGAATTTGCATGAATTGTCAAACCCAAGG
TCTTCTGACGTGGCATCGTACTGGATTCGCTGTCCTTCTACACCATGAGGATGGAAATAACAGGTATACTGACTCCAGTCAAATATGTCAGAGCCCTCAG
TTCTTTCAATCGCCAGAGGAGTTGCACTCTTGATCGCCACCTCTGCGGAATAGCTCAATTCAAGCATCTTAACGCTCCCAGTCGCTTCCACAGCGTTGGT
TACAGCACTCAAACCAACGTAGCTTTCGTTGCGCATAAGCTCTACCGAGAAGCGTATTTTGCCCAATAACCcttctgttgctggcgttATCCTTACTTTT
GGGTTCGGTTGGCCTACAACTGGAAGTAGCCTCGCGTCCACCCGAGCACGGTTTTGCTGATCCAACAAGAGTTCTTCGGTCACAGGTTTTCCATACAGAT
CAGCGTGCTCAAGCATTAACCCTTTAATGTACCCAGTCTTGTTTCGCTGAAACTTGATCTTCACACAGCCAAGTGGAGCATTCGCCGATGTAGCATTATA
GTCCATCACACGTAGTAGTATggacttcttgttgctgagcGCCGTGCTTTCTGTTCCACCAAGAATGAACTCTTGATTCTCCCACTTTGGATTTAATGTT
CTCATTTTTAAATCTGTCTTCAAGTCTGTGCGGTGCTCTTTCATCGAAAAGCCTTCGTGCAACAACATAATCTCCACAAAAGGGTCACCAGTTAGCACGT
CTGTCATGCGTAGCTTTCGACACTCCAGACTGGTTATCTTGATAAATGACGGCTCTCTCACCACCGAAAACGATATTTCCGGGCTTCGCGAAATGTCCGA
ATCAAAATCTGGCATTAAGGGGGCCTCGTTCTTTACAGCTTCCAGAGGTGAGGGGGTCTTTTTACTACGATTCATCTCCTTTTCGTTTAATAGCTTGAGC
TCCACTCTCATCTGTCCCAGATTGGCTCTCTGGAGCATGTttggtgcaggtgcaagAGGATACCATGCATCGATGGTACGATGAGCGGATATCGACTTGA
TAGGAATATTGAGGACACCCAGTAGTTTGTGCTGATATCGGTTCTTCACCATGCGCGTCACGCAACTCTCTAGGTCAGCGGATTTGAACAAAATATTGAG
ATTTGTGCAGCTTTCGCTAACTTTCTCAGGGTCCAGGTCGCCTTCATTTGTGCGAATATGCTCACGCATGAGCCCCTCCTCGATAAATGGCTCGCCAGAA
TTTATGTACTCAACATCATAGAGTAAGAACACATCGCGAAGCGGCATGGGCAGATTCATCCACGACGCCTTGTCAATCACCTGGTACTTGTTCAGCAGTG
CATCAacagctgctggagcttcagTTCTACTCTTGCGATCGTACAATGTTGTGAAGCTGTACGCCGTATCGGTGTATGGTGTGCGAATACGAACAATTTG
TCCAGCATAAAGCGAATCCTTACTGAAATTTCCACCATGCTTAGGTTTGGCTTTAAGCCTAACACCTTTACCGTAGTATGCCATTACAGTATcacctgca
gctcctgttttcttcagctcgttGCGTATTTGCACACGGAGTTGACGCAGCTTATTGTCGTGCTTTGTATGCGAAAAATCCTTGTCATGCCCAAAAAAAC
GGTTCAGAAGCCGGTGGAAGCTCCCTTCAACATCGTGGTGATCAAATTCCGCAGCAAAATCAATGCATTTCTGCTCCAGAACCTTTGGATTCAACTGTTT
CATGACCACCACTTGCCCTGGACACAAACCAACACTTATACCTGCGCGAAGAAATGATTGGGCCCACCGCTGGGCTTCGTACGTCTTGAACTCAATGATT
TTCTCGCCGTTATCCCGAGATCTCACCATTTTCTCGACTAGGGCAGAACTGACGGGGAAAATCTCTTGGGAATTCAGCTGTTTTACGCGTATTGACGCAT
TTACTATATCCAGCCACCCACCTTTACCCTCCTTCGTGATGTTGTACCCAACTCGGCACCCAACGCGTGTCATGTCAATGATGGCAATCGGAGCAATTGA
GTTATCCCCTTCGTATATGTACAAACATTTGCGAGATGACACGAAAAGGGAATATTTCCAACACCACGAGGCATGTTCGTCAACAAGTCGATGGATCTTG
TCCTCACCAGGTGGCAGAATGGGAAGTTTCAGTTCCTTCACCTCCGGAGTAAACAGCATATTGGAGAGCACCAAGTGCACACCAAGCAATCCATCGCAAT
ACTCGGTAAGGTTTTTCGCGTACGTTTTGCTTCTACAGGAGACACTTGGGGTGCCATATAGCTGCTTTCTGGCGTCTCCTTCAACAAACTCAAACGGCAA
TACAACAGAAGTACGATGGATGTCAATCTCCTGAACAAGATCCAACGGGAAAATACTGTTTTCACGCGGTTGGTTCTGCATCCACATTTCGACCTCCCGC
AAACGGTAATAGCGATCCATCTTGTCTTCCATCATCATATGTCGTTTCCCCCAGTCTGGCAATGCTGTGATGATAGGAGAAATGCTTTCAATaaatccag
cagcacacaaTGCACTGAGCCATTGTAGTGCATATTCCCGCGTCCGTGGTGCTTGAATTGCGTCAGGATCAAAATCTAAGCTTGGGTCATCCCAACCCAA
TCGACACGACGACAGAACTGTGGCGTCTCGGCAATACTTTGTCCACCCGTCTTCCCATAAAGCAGGAGGTGAACGAAGGATCCACGAGACCATCCCTTCG
CCTGTGAAACTACGCGGTACCCGAACTCTACCAGTAGTTTGGTCCTGCATAAAAAAACAATCATTCTCGCGGAGTAGTTTCTGGCGCGTGGCACGCAGGC
AAACCCAATCCTCTCGGGATATATCAGTAGCCGGGGACACCTCAGGTGTATCTATTGCTGCTATGTCTAAAAGTTCCATTTCCAGTTGAACAACGATATT
TTTTCGTGTTTCAACCGGCAGCTCATTTATTGTTCTACCGAGCCATTGACTGTCCAGATCAGCGCTCACGTTGTACACTAGACGACACTCACGTCTTGCA
TCATCGGAGAGTGATTCAAACTCCTCGAACTGACGTATCTCGCGTAATATACTCACGATTCGCTTCATAATAACCACTAACGCGGTATGAAAAGCGTCAA
TCTGCGAATTCTCCGTTGGAGAAAGTGATAAGCGCAGCGCTTGCCGGCGCTTGATTTTAGTCTGAAGAGTATACGTTGGTGATGCTTGTGTTTCATTAAC
CAACTGGTGTTGGTACCACATCGTTAGCCCGCATTGATATATTCGACGCTCATTCATCCCATCTTCGGTGACAGGTTTCTTTTGTACTGCTTCAAGGGAT
TGTGGTACAAGCACTTTCTCATTGCCAGTTGTTGTACACGTAATCCTGACGAATAGGGATCCTACAAAGGTGTAATACGGAACCCCAGTCTCATCTGGAG
GAATCACTTGCAAATGAAGATCTTGTTGCCCATTTTGCAGCGAGGTGAGGTCAAGTTTTGCCAATCCAATGACTTTGTCGGCGACATTAAGCCCAGAAGT
GTCCGCATTATCCATCACACGGATCAATATACTTGAAGTGCGGCTAAGGATTGTCATTTCCCTATCCATGTTATTTGCACCATTTGGGAGTTGGTCCGCG
TCATCCATCGATACACTAGTAGTATCCACTTTGCCAAACATGATGGGATTCTGCTGGAATAAATGTATGTCGTTGCTTTGTGCACTTCCATGAAGAACAG
CAGCCTCCAAGCGATTGTTTGCCTTCCAACTCCATTTGGATGATTCCACTGTGTCATTCACAACCAACTCGCCTTGACTGTTAAAGCTACAAAACGTAGT
GGGTTGGGAATGTGCTTTTCCTAGCCAAGTGATCAAACACATAGGTTTTATGGCTTTGTCGAGCTTCACGGGACTTCCAGGCTCGCTTACAACCATCATG
AGGTTTGACGCCGACAAAATATCGATTATAATTCCTGTAAATTTGTGTTCCATCTTCTCCCATCGATCGTTCTCTTCTTTTGTCACATCAAAGCGTCTTG
CCATCACTATCTCTGCCTGTTTGGTTAGGCTGTTCATAGGGGCAACCTGGGTAGCTTTGACAGTACATCGTGTCTGACGTGTAGGTGGGGTTAGATTTGA
TATTACGTCGCTGTCGTTAATGCTCACATCGACTCGACCATCACTATGGATTGCATGCACCTTTCCCTTTACATCAATTGAAAAAAGGTTCCACAAATCA
TCGATCGTTTCGATTTCATCCTCAAAGCGAATGTCATACTCATTCAGTGGGAAGGGAATGTACTTCTGGATGTGCGCCGGGTAAAAACGTCCACCATCGT
GACATCGGCGAAAAGCCAATACCCGTTGACCATATTGCAAGACCTCGAaaccatcatcatctatCTCTCCAGATGACGAGAGTTTGTGGAGTTGAAAGCG
TCTAAGCCGCACATCTTGTTTTCTTTCGTCAATACTGAGCAAATTCGAGAGTGGTTGCTTTTCGTCGCCTTGAAATTCACGTTCATATACATGAACAGAA
AGATGCGAGAAAGTAGTGATGTCCTTAACTTTACCAAAAATGAACTCCTGTTCCGGCCAATACGGATCAGGAGTGCCGTAGACCGTTAGACCTTGCTTCT
GTTCAGCATATTCCAGCTTTCCATCGTCCAAAACAGGAGTCACTGTGAAGAAAACGTTTATCTTAGCTCGTGACTGCTCCACGTGAGGCCCACTAGCTTG
TGAAACCCCATCTGCATCAAGCTCGCTTGATGAATGTGATATCCCAGTACTGATTTGATGTCCAATTGCAGAAGAAACAGCTAAACGTCTAGCCTCGTGG
ACGCGCAAATGAAGCGACAAATTATCAATGTTTGCGCACTTGGTATTGCTGAAAATTCCGGCGAACGACAACGAAAGTGAGGCCTTTTCCTTGCGCCACG
CAACTGCGGTGCTGGTCACTAGCGATGTACACGAAGGATTTCCATACCCACTGAGTTCTGTTTTTTTGTCTCCAAGCTCAGAATCACCTTGATCTGTCAA
CATCATCTCCCGTACAGGTTTACTTTGCATATTGG