Description :
From Genome Similarity Track
Location :
Scaffold_103:43074- 44341
Sequence
1267 bases(100 bases per row)
TCCTTAGAGCATCAACAACATCCACAAGTATCTTTAACACTGAAAGATCTATCAGCACTTTACTATTTAGCACACAAAACACAACCCATATTCTAGCCGC
TAACTACTACAAATGCAAAGTGAACGTATAGAACTTGATCAGTTTCTTGTACTGAATTACTTATATCAAAGGGCGAGCTCCACGGCTTGCTCCCTTATCT
TACATGTCAGTTTATATCAATATTTCCATTATTTTTGAAAACAAAATTTATGTTGTTTTGCAGCGGAAGTTTTTCAGACGTTCCTTGGAGCATCGACTGC
CAATGGTAATAACTTTACTCAAATTGCAACATATTTACATCAATTTTCTGTGGTAAAGCGAATAAAAAAAAGATAGAGGATCAGGATCTGGAGCTCGCCC
CTTATATGAGTAATTCAGCCCATAGAAATGAATCAAGTTATGTATATTCACGTTCCCATTTTAGAGGTTCGGCAGCGAAAAAATGGTTCGTAGTATGTGT
GCTTATCAATAAGAGTGCTGATGGTGACTTTATTAAAGCTACTTGTTGAGGTTGTTAATTTTCTAAAATAGACGGATATTGTAACGGGCTGAGTCCATTA
CATGGTATTTTCAATAAAGTACATAACAAGTGTGAATGCTATGTTTAATAAAGACATCGTAATACTGTGATGTAGAAGTCATATACTGTTTTTTGGTTGA
TACAGGACGATGACATCAACCAATAAAGCGAGCCACGACAGAAGAACGCAACGAGTGGTGAGCAGATAGTTACAATACATGTTTGCATTTAGGTACAGGT
AAAAGAAGACTGAACAGAATTTATAAACAGGAGAATAACTATACTAAATACAGCTCTACCTTTCACTTTTATCTTGTATTGAAACATTCCTCTGCACGAT
ACGTGTACGTGAGATTCTGTGGCACCTGCTTACCCTGTGTTCGGAGTAAGTAGCTTGTACTGTGACAGTACAAGCGATCGGTACCCCGTTACACCTGGTA
GCACTTCGTAGTCCGTCCAACGACTATGAATATGTTGGATAATGAAGCGAAAGACTTCCACCCAACGCACGAGAGCTATTCCCATTTGATTCAAATCTAA
TGGGATGCCGTGGATTGAGATCAACGATAGGGCAAGAAGCGGTCGTTGCAATGTTGTCCAGCCTGGGTCCAGACGGACAACACGCCGCCATCGCCAAGTT
GATACAGAATGAACCTGACGCTGAATGAATAAATGTAACCTTGCTTCNNNNNNNNNNNNNNNNNNNN