Description :
From Genome Similarity Track
Location :
Scaffold_60:43067- 50716
Sequence
7649 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGCCATACATCTCGTCGATGATCCGATCATCGG
CTGCAGTGGAATAACACCAGGACGAATTTCCCGGTCCTCATCCTCAGGCACAGGTGGATTCTCAATCAGCATATCGCGCGGGATCTTCATGTACTCGTTT
CCTAGGGAAGGGTTTACATCATGCCTTCCCTCCCCGACTTGCAGCAGGAGCTCGGAGAACGCAGCCATTTCCTCAGCAGTGTCTACAGTATCAGCTGTGC
GCACTCGCATGTTTTCCGTAAGACGGAACGTCTGGAATTGGGGCCACAGCCTAGACGACTTGAGGCAAGCGTCAATTGTCTCGACGGGTGTTCCATTCTT
AACGACCGGGAGAATCTGGCGGAAATCTCCCGAAAGTACAAACACTTTCCCCCCAAAAGGCTCGGTATCGTTGTCAAGTATGTCCCGCAGTGTTCTGTCT
ACTGCCTCGAATGCGTGGCGATGGGCCATAGGTGCTTCGTCCCAAATAATTAAACTTGCATGCTTGATCAACTCCTGAATATGGGAGTTCTTCCTGATAC
CGCACGTCGAGCTCTCGTTCAATTTCAAAGGGATCTTGAATGTAGAATGAGCTGTCCTACCACCCATGAGCAAGAGCGAGGCAATACCGCTAGACGCCAC
AGCGATGGCGATTTTCCCCGAGAGTCTGACTTTGGCCAGTATGTTTCGAAGCAGTGTAGATTTTCCAGTACCACCCGGGCCATCGACAAAAAATAGTTTC
TTGCCTTCCTCCGGCATTCAACCGCTTCAATAATCTGGTCGTAAACCACCCGCTGACTTTCGTTTAGCTGATCTTCTGTGCTTACAATTGCCTCCAAAGC
TGACGCATCGTATCCAGTGAGCTCACGTCGTAGTAATCCGTTTTGGCGAAGCGCTTCACGAATCAATGTTGGGAACGACCCCAACTGAGGAAGCTCGTCG
AAGTCAGCTACCGCATACCCACTCGCTTGAAGTAGTTCTTGAATGCTCATCAGCGTTTCAAATTCGACCAACGCCGACTTAAAGGGGTCCCTCAAAGCCT
GATGTTTGCGTGCGAAGTCTTGGGAAAGATCCGCGAAAAACCGATCCCATAGAACACCAACATTTGCTGGAGCTGAATACACCAGAATGTGACGAAGAGC
TGGCGTAGTTGATACGGCATTTGGAACTCAGCCGCTTCCCTCAAACACGAAACCCACTCGTTGTCATTCTCTAAGTAGCCAGCCTCCCGCGCCGCAATTT
GGAATGTTGGGCAGACAATCCCGTTAACCGTTCTCAAGTCTTCAAACGACGTTGGACCTCTACGCTGACAGAGCAGTAGCCGAAGATAGAACCGCTCCAT
GTCTCGAGGAGACACATGAATCATGCGACCAACCGCAGCTTGATACTGTTTCCTGCGAACCCACCTTTTCGGATGCCCGTTTCTCGGCGCTTCCAGCAGA
CTCTTTGGGATATCCTGATACAGCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCGGCAGGTTTTCCAGTGACAGCACTCTTCCCTTTCTGTCTTGGATAATTCAG
CGCCCACTTCGGGAACTTCTTCGTGGTAGGTTCCAGCCCCTTCTCCTCTATTATGAAAGAGACAGCGAGTTAGTTGGAGTGAGTTTCGTTAATCGGCGTG
AGTTCTCAACCAAATCGTAGCCAGCCTTTGATCGCGTGTTAAAGGAGCAGTAGATTCCGGAGCTTGAAGCCAGGGTTGCCATCCTCAATGAGAGTCGGCA
GCCACTTCAGACACAGTGGGCGCGGTTTATGCGTCCTCTGGTCGCGAAGAAGTTATCATGGCAGACGGAAAGACCAAGTCTTCTGGAGTCCTCCGTGTTG
TGTTTGACGCACTTGCCTGCCCAAAGTGGAGGAACCGTTGCGCCTAATGGGTTGTGCTCTGCCCATCATTTTCTCGATGTCTAGTAGTGCAACACGATCC
CAGATCCGCGAAATATACCAAGACGTCGCTCCGCGCGGCCGTTGCATGTCTGGATCCACAATGTAGATCTGCGCAAACTTGGGTGCTACTCGCGCGCCTG
TCCGACGGTCTATGTGGGGGAGGAGAGATCCTAGGTAGTGCCCCATAGCCCCTTGAATGCGATATGTGTACACCCCGTGTGTACCCGCAACGCTCTCGTC
TTGATGCACATTTTGAAACGATCGGTTTGAGCACGAAGCACCAATCGATGTAAACGCGAAGGCTTGGTTGTAAGCACGAATTTGACGGCGGAACTCGGGA
TCTCCGTACAGCTGAAGCAGCTTCCGTGGCGCGGGGTGCAGTGGAGGCAGATTTACCCTGCCTGCGAGACAGCATGATATCGCAGACTCCCCAGGCCACT
TCCAAGCATTGCAGATCGGACAAACTGTTGTAGCCGGGAGCTTGTGTCGCCCGTTGACCACGTGGTCACCTGTTATCATGGACGCGTCGAAGTCTTCGAG
GGAAATAAGAGCATGTCCATGACGGACACATTGTCGTCTAGTGCGCACCCGCTCGAGCTCGTACTGGCGCTCGTCTTGTGTCTGCTCAGCTCGTCGATCA
GCATGCCGTTGTCGGTCCAGCTCGCGCTCAGCATCTCGTTCTTGTCCCGACAGATCGGCCCGTCGATCGGCGTGCTGGTGGCGGTTTAGCTCACGTTCAG
CGTCCCGGTCTTCTTGTGGTAGCTCTGCTCGGCGAACCGCATGCTGTTGGCGGTTTAGGTCGCGTTCGTATTGTCGCTGCTGTTCATTTAGCTCCGCCCT
GTGTGCTGTTTGCTGCTGCCGATTATTCACTCGTTGTTCGTGAAGATCTTCTCCACGTAACCGAGCTCTTCGGGCACGCTTGCGCTCTGCGTCCTTTTTC
CTCGCACGATCACGCTGAGAGAGTGACATATTAGCTCGTCTTGTGCGAGATCTCTGTGCGTCGCATGTACGGTCGCGATCTGTCTGAGACAGTGTCCTGT
TAGCTCGTCTTTCGCGAGCTCGTTGCGCAGCTGACACCGGAATCGCTTCTTGAACAGGAGCTGGAGGTATTAAAAGCACTGCCAATGAAGCCACCTCGGT
AGCTCCCGCTTGATACGCTGCCTCCATCTGGGCCGCAAACCGGCGCTGAAATATAACAGGATCGGACTCTTCCGTCTTTTCCTCCCGCTCTTCAAAACGG
CCAGCTTGACCTTCCGTAACTTCCGTAACCGCAGTTGCTTCTTGGTGCACACTGAGGGCTTGAAGCGCTTTGTTCAAGTCGCAGCGCTTCCTCCTGCGCT
TGTTCATACGTCGCTTCCGTGCTTCCTTCTCCTCTTGCATGGGTGTCGCATTGATCAGTTCATTCTCGCGCAGAGCCTCCTCAAGTTCTTCCCGCGTCCT
TTTCCGCTTAGTTCGAGCCATCAGCCTGCGAACACGAAAACGTGACGCGTTAGACATAGTCTAAGTACACCGCACGTAGCAGTAGTTTTCATAATGTAGG
GTGTGGGGACATCTGCGTACTACCCGGGATTGCTTGCTCCCATCAAGGTTATCTCCGATCACTTATCCCATAGTCACGGGCCGTCAGGCCCGGAGCGGTT
TTAGTTTGCAAATTGTGCAGTCGAATCTTCAGGGTTGGGCCCCTGGATAGTACTGTAGCTTGAGGTGCGATATCCTTTTGCCAAAAAGGCGGCCGTTAAT
TGCAAAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCCATCTGTCGGTTAAAAGGGGCCAGTTACGGTACCCCTCCTAACCAACTGCACGCACGCA
ATGTGCGTGCCCATCAATAACCGTTAACGACCGGCTCAACTGGTTCGCTGTCGGGTTTGCGGTCAATGGACCAGGTGCCAAATGTGCTCTCGCGCAGAGT
GGGCGGTAAGATAAAGCCCCAAGAACCCAGAGGGCTCTGGAACTAAATCCCCATAGCACGGCTACCTACTTGCAGGATAAAAAATCCCGCAAGTTATAAG
CTACCGCCTAGGCAGCCCCAGGAACCTCGGACTATCTGTCTATGTGTGTCTTGCTAGCTACTAATGTAAAGTAACATGCATACACGCAGCGTACCTCGAG
TAACGTGGCGTTCCGCGGCTTCCGTTTCGAAAATGGGGGCAAAATGAAATTTAAACGGTGCTTTTAAGGACGATGTGTAGACCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCACCGGCTTCCTGATACTCAGTCTTTCGTGACCGCTTCTGCCTCCCATAG
CTGGTACTCTAGCCGAAGGGTGCTTTTCCGTGGTTTGGAGCCTCCACGCAGTCGTGTTGTTCCAGCACCCGTGTATCGGGCTCGTTTGGTGAGGCCCCAT
CGACCGCGTTATAACGCCATCGTGTAATTGCGATATGGTTTTGCTGTCTATGGTATTGTGCTCGCGGATTGCATCTGCATTGCCCATGTTATCGTGCTCT
ACAACGGCATCGTCCTCCACAATCGTGGTCACCACGAGCCCCCTTCCAT