Description :
From Genome Similarity Track
Location :
contig_61:43062- 45733
Transcript NameFunction/comments
g11329.t1hypothetical protein

Sequence
2671 bases(100 bases per row)
ACCCCATTCCCGATTGATCCCCTCGGGACGCACGTCGCCAATATGGAGCCGCGCGCCCGCCGTCTCAGTAACATCCGCGAGCCGCCGCTGGCTCCGACGT
TCCCTACCAAGAGCTTCAGCCATTCGAGCAGCAGTCGCGGCCTCTCGTCCTCGCGCTCGTTGTCCACGGCGGTGGTGCTGCGACTGCTACTGGGGCTACT
GTGCGTTGGCATCGTCTTGCAGTGGGTCCTCTGGAGCTCCAGCGTCGTGGAGCCGCAGCGCAGCAAGGAAGACAACGGCTGGATGAACCACTTGCGACGA
ATTGAGCACGCGGCTGACAAGGAAACGCCTGAGCCCGCCGCTGACACGTTCGAGTTCGAACCGCCCGCCAGCGACCCGACCCACGAGGAGGAGCAGCGAC
GACGAGCACCGTACGATCCGGCGATGCACAATGAGGACCAGAAGCAGGTAGTCGAGATGGTACAATGGGCCTGGAAGGGCTACTCCACGTACGCCTATGG
CCACGACTCGCTGAATGTCAAGACGTACAAGGGCACTGGGCTGCCAGATCATGACATGGCACTGACACTTGTGGACGCGCTGGATACACTATACCTCGTG
GGTATGTTCGACGAGTTTGATCGGGCGAGTGAATGGGTGGCGAATAATATGGAGCAACGGATTTTCCTCAGTGGCTTCATCAGCTTCTTTGAGACGACGA
TTCGCCTGATGGGAGGACTCTTGTCGTCATATTATTTGTCGGGGCATGTGCATTTGCTCACAATTGCGAATAAGCTGGGCATGGCGCTTTCTCCAGCGTT
TGAGGTGTATGAACACGGTATTCCGGCCAAGGACTTCGATATTGTGGTACGTGGCATTCGGTGTCTCTATAGGATTTTTTTGTAGGATGCAAACGAAGGA
AAATAATTTATTTGTGTTGCTTGGTGTGGTGGTGCTTAGACGAAGCGGACACGAGCTGCCCCCTCTCTAGCAGAAGTTGGCACACTGCAGATGGAGTTCA
AGTACCTCACTCGACTGACCGGATACCCGAAATACCAAGAGCAGGTCGACCGTATTTCGGATTCAGTACGTTCTGTTACTAATAGTGAGCGCTTGTGCTG
CTTACGATGGACTTACCTGCCTACTTCTTCTGCTTGTTTATATCATGTAGCTTGCGAAGCAAGTGGAGGAGAAGTACACAAACGGTCTTCTGCCGGTTCA
ACTGAATCAGCAAAACGGAAAAATCACCCAGTCGAAAATCACTCTGGGCGCTAATGGTGACAGCTACTACGAGTACCTGCTGAAGCAGGTAAAGTGTAGT
GGTCGAATGAACTTAGCTAATGCGTGGCTGACTCTCTTTGCGTTGTTGATACGCAGTGGCTCTTGTCGGGCAAGAAGGACGACAAGTTCAAGACGCAGTA
CATGACGGCAGTGGATGGAATCATAGACAAGCTCTGGGTAAGTCAAAGCCCAATGGCTTGGTATTCATTGGAGAGCTGGTGTACGGCAAGTTCGAGCCCA
AGATGGACCACTTGGTGTGCTTCGTGCCAGGTATGCTGGCGCTAGGTTACATGAACGGCATGCCTGAGGAGCATCTCACGCTTGCGAAACAGCTCATCGA
AACGTGCTACCAAATGTACGCTCAGATGGAGGCTAAGCTTGCCCCCGAGATCATGTATTTCAACATGAAGGAGAACGTGGAAGAGGACTTACTCGTCAGC
GCCACTGACGCTTTCAACTTACTGCGTCCCGAAACGGTGGAGAGCTTGATGGTGCTGTATCGTGCCACAAAGGACGAAAAATACCGCGAGTACGGTCGTG
ATATCATGAAAGCATTCGAAAAGAACTGCCGATTAGACCGAGGTGGCTACGCAAGTATTGGCAACGTTGCCAAGGGCCCAATTCACATTGGCTTCCGCAA
CGAAATGGAGAGCTTCTTCATCGCTGAGACGCTCAAGTATCTATTCCTGCTGTTCTCGGACGACTCGATGCTGGCCTTGGATGAGGTTGTGTTCAACACG
GAAGCCCACCCGTTCCCGATAGACAAAACCAACTCATAGATATGTGAAGGACGCGTCTCCAATATTCGTGCTGCATTCTCGGTGTTGTGCTAATCCAATT
CGTGTAAATCGACGAGTGGAGCTTCATGTTAGATTAACGGACTGGCCTCTCGTCTGTGGTATTTTCAGCAGCTCTAACGAAACGATTCCTGAGAGGCAGT
ATTGATCCGTCATTGTAGATGAGCTCATCCCGAGGTGCAAATTACAGATGGGTGGTGCAGCGTCTGTCCTAGGCGAATCGGCCTCAAATTTGCACTACAG
ATATGGCGAGGTTACAGACGTGCCAGGCGACAAAGCGGATGAGGACCCAGTGTCCGCAGCATGGATCGGCACGAGGCTGGACATGCCGCCGAAGCCCTTT
AGCCTCGAGAACTACTTCGAGTTGTTGGACATCGTAGGCACTGGTATGCTGGGCAAAGTACGTCTCATTCGGCACAAGCGTTCAAGTCTGTACTACGTGT
TGAAGTCGATCAAGAAGAAGGAAGCGATTGTCAAGAAGATGACCCTGCAGCTTGAAGCCGAGCGTGACGCGATGGTCCAGATGACAGCAGTTCGACATCC
GTTCACGGTGCGGTACTTCGGCAGTTTGGCCACGTCTTCGCATGTACATTTTCTGATGGAGTATGTACCTG